D9Rat44 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Rat44

Symbol: D9Rat44
Also known as: R0022-D07; oxsts7533; R022-D07; 
RGD ID: 35695
Expected Size: 176 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.295,109,826 - 5,109,995 (+)MAPPER
Rnor_6.092,880,977 - 2,881,145NCBIRnor6.0
Rnor_5.092,813,697 - 2,813,865UniSTSRnor5.0
RGSC_v3.492,948,882 - 2,949,051RGDRGSC3.4
RGSC_v3.492,948,883 - 2,949,051UniSTSRGSC3.4
RGSC_v3.192,948,882 - 2,949,051RGD
Celera91,991,507 - 1,991,679UniSTS
SHRSP x BN Map91.33UniSTS
SHRSP x BN Map91.33RGD
FHH x ACI Map90.08RGD
Cytogenetic Map9 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   DA.BN-(D9Wox24-D9Rat44)/Kini   DA.PVG.1AV1-(D9Wox24-D9Rat44)/Kini  
QTLs:   Cia15   Bw4   Gmadr4  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GAACCAGCAATACTAGAAGGATGA
Reverse Primer AATTGAGTGTCACTTGCTCTCC
 

Region

Nucleotide Sequences
GenBank Nucleotide JH616636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10054141Gmadr4Adrenal mass QTL 42.450.0074adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)9116520166Rat
70226Eae4Experimental allergic encephalomyelitis QTL 4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)9129467098Rat
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9140383872Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9140383872Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9140383872Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9145029794Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9105522293442944Rat
1578675Bss17Bone structure and strength QTL 173.8femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)9190783415555026Rat
631533Iresp3Immunoglobin response QTL316.2blood immunoglobulin E amount (VT:0002492)serum total immunoglobulin E level (CMO:0001542)920055833309921Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9235572247355722Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9235572247355722Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9288097747375681Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9288097747880977Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326433 UniSTS
  326452 UniSTS
  369042 UniSTS
UniSTS 122539 UniSTS