D15Rat130 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D15Rat130

Symbol: D15Rat130
Previously known as: R0008-D02; oxsts9636; 
RGD ID: 35417
Expected Size: 166 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21521,925,746 - 21,925,910 (+)MAPPERmRatBN7.2
Rnor_6.01525,484,123 - 25,484,286NCBIRnor6.0
Rnor_5.01529,409,222 - 29,409,385UniSTSRnor5.0
RGSC_v3.41524,605,491 - 24,605,654RGDRGSC3.4
RGSC_v3.41524,605,491 - 24,605,654UniSTSRGSC3.4
RGSC_v3.11524,621,191 - 24,621,354RGD
Celera1522,303,763 - 22,303,926UniSTS
FHH x ACI Map1519.6699RGD
FHH x ACI Map1519.6699UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGTACCAACAAGGATAGGATG
Reverse Primer GAGCCGTCAAAATTTGCATC
 
Template 
GGTCGACTCTAGAGGATCCCCAAATACCATGCATGTCCTTTNNGGGTCTGCATTGCCACACACA
GGATGATATTTTCTAGTTCCATCCATAGCTGAAAGGTCACCCATTATGTAAAGGAACACATTTT
CTGTATCCATTCTTTGGTTGAGGGACAAGACCANNTGGTACCAACAAGGATAGGATGCACACAC
ACACACACACACACACACACACACACACNCACACANANTNCGNGNCAAAGTGCAGGCGTCCANA
CTCATGANNCAAAAACATTCTTTTTNNAAANNTGAGAATTTACTAGATGTTGGATGCAAATTTT
GACGGCTCGACGAGTTGGCAGTATTGAAGAGTCCACATGCTTTCTGAAGTGTATTGCTATCTCT
GAGAGAATGCTTCATGGTCATTTTGTGTGTTGATGAATTNTGTTGGCTCTCTCTTTANTGCTGN
TGTNGGGGACAAGTGTAGGTGANAGCAGCGGCCTGGTAGCCTGGAGGGACGGACGC

Region

Nucleotide Sequences
GenBank Nucleotide CH474040 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15129912054Rat
8552920Pigfal8Plasma insulin-like growth factor 1 level QTL 83blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)15134723002Rat
8694361Abfw6Abdominal fat weight QTL 610.20.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)15134723002Rat
9589149Insul29Insulin level QTL 299.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)15134723002Rat
731170Pur3Proteinuria QTL 32.30.0005urine protein amount (VT:0005160)urine protein excretion rate (CMO:0000759)15141686771Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15142356671Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1530632945306329Rat
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)colorectal tumor number (CMO:0001794)15226636822711984Rat
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15226636822711984Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15226636846921453Rat
1582251Gluco24Glucose level QTL 243.20.0008blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)15553075650530756Rat
631273Lecl2Lens clarity QTL 20.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)151059608955596089Rat
2300167Bmd63Bone mineral density QTL 635.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2300173Bmd62Bone mineral density QTL 6212.80.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2293688Bss29Bone structure and strength QTL 295.310.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)151111114256111142Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151249614165205939Rat
5685002Bss103Bone structure and strength QTL 1032.8tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)151448116528469888Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
631550Bw7Body weight QTL 73.6body mass (VT:0001259)body weight (CMO:0000012)151985656634924750Rat
2324620Coatc3Coat color QTL 3coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)151985656646187442Rat


Additional Information

Database Acc Id Source(s)
UniSTS 226690 UniSTS