D17Rat30 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D17Rat30

Symbol: D17Rat30
Previously known as: R0012-A08; oxsts6368; R012-A08; 
RGD ID: 35062
Expected Size: 170 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21758,124,564 - 58,124,741 (-)MAPPERmRatBN7.2
Rnor_6.01766,415,264 - 66,415,440NCBIRnor6.0
Rnor_5.01768,161,020 - 68,161,196UniSTSRnor5.0
RGSC_v3.41768,686,024 - 68,686,200UniSTSRGSC3.4
RGSC_v3.41768,686,023 - 68,686,200RGDRGSC3.4
RGSC_v3.11768,696,857 - 68,697,033RGD
Celera1762,409,113 - 62,409,289UniSTS
RH 3.4 Map17606.5RGD
RH 3.4 Map17606.5UniSTS
RH 2.0 Map17514.0RGD
SHRSP x BN Map1732.6999RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GAGCGATGGGATGTTGAGTT
Reverse Primer GTGCAATATGCATGAGTGCC
 
Template
GCAAGTTGCATTNTGCAGGTCGACTCTAGAGGATCCCCCCTTCTGTGCACTNGCACAGATGATC
TCAAGATGTGAGCGATGGGATGTTGAGTTCAATGTGTCTCATGAATATACTCTTCAAAACAACA
GCTTNCNAAATCCCTGTGGTTCCACTGAAGTCAGCCTCTGTGGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTTGCACACATGTGTGCAGGCACTCATGCATATTGCACCTCAGATGCC
AGCCATCTTTGTTTTTCTTTATTTTTACTCTCTCTTTATTGAGGCACAATCTCTTACGGGGGTA
CCGAGCTCGAATTCGTAATCATGGTCATAGCTGTNTCCTGTGTGAAATTGTTATCCGCTCACAA
TTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTA
ACTCACATTNATTGCGTNGNCTCACTGCNCGCTTTCCAGTCGGGAAACTGTCGTNCAGNTCATT
TNTGAATCNNNNACGCGCGGGGGAGAGGCGGNTTTCGTATTTGGGNGCAGGGNGGTTTTTNTTT
CACAGT

Region

Nucleotide Sequences
GenBank Nucleotide JH619067.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172702794960463643Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173136839162109574Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173583708569599340Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174135465160463643Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)174207316069599340Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)174207316069599340Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)175089090860781592Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)175089090860781592Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
2317053Aia25Adjuvant induced arthritis QTL 252.69joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)175090919660781426Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
61466Niddm12Non-insulin dependent diabetes mellitus QTL 123.20.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)175402992960463637Rat
70210Cm15Cardiac mass QTL 156.5heart right ventricle mass (VT:0007033)heart right ventricle wet weight (CMO:0000072)175724672370156904Rat
1600398Edcs5Endometrial carcinoma susceptibility QTL 52.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)175724672370852846Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)175724684382046127Rat


Additional Information

Database Acc Id Source(s)
UniSTS 119324 UniSTS