DXRat66 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXRat66

Symbol: DXRat66
Also known as: R0009-B12; oxsts7617; 
RGD ID: 34991
Expected Size: 138 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X110,639,479 - 110,639,627 (+)MAPPERmRatBN7.2
Rnor_6.0X36,769,460 - 36,769,609NCBIRnor6.0
Rnor_6.0X118,083,215 - 118,083,362NCBIRnor6.0
Rnor_5.0X118,224,438 - 118,224,585UniSTSRnor5.0
RGSC_v3.4X31,245,654 - 31,245,802RGDRGSC3.4
RGSC_v3.4X31,245,655 - 31,245,802UniSTSRGSC3.4
RGSC_v3.1X31,299,123 - 31,299,271RGD
CeleraX109,957,262 - 109,957,405UniSTS
SHRSP x BN MapX31.99RGD
SHRSP x BN MapX31.99UniSTS
Cytogenetic MapXq34-q35.1UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia19  
Genes:   Htr2c  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCCCCAGAGAGATAGACCAG
Reverse Primer AGCGGTGGGGAAACACTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596945Phka2phosphorylase kinase regulatory subunit alpha 2X3597065036926616Rat
628618Adgrg2adhesion G protein-coupled receptor G2X3693018637054968Rat
9332997LOC10369082460S ribosomal protein L15 pseudogeneX3698755036988234Rat
1560997Rps27a-ps5ribosomal protein S27a, pseudogene 5X3702643737026904Rat
1594258LOC678972similar to chaperonin subunit 6a (zeta)X3709618137138552Rat
6499893LOC100910203WD repeat-containing protein 76-likeX3715517737157528Rat
7595622LOC102555147uncharacterized LOC102555147X3721034037236462Rat
1584890LOC367796similar to 60S ribosomal protein L13X3725399837256572Rat
2319924LOC100361543RhoA activator C11orf59-likeX3726142837262470Rat
3286Pdha1pyruvate dehydrogenase E1 subunit alpha 1X3732977937343410Rat
1560603Map3k15mitogen-activated protein kinase kinase kinase 15X3734225137755373Rat
9148120LOC103694482mitogen-activated protein kinase kinase kinase 15-likeX3734234237343452Rat
1563860Rps6ka3ribosomal protein S6 kinase A3X3746973637576055Rat
9395807LOC103694480uncharacterized LOC103694480X3752452637525725Rat
1560198Eif1axeukaryotic translation initiation factor 1A, X-linkedX3757995937595300Rat
9268945LOC103694479uncharacterized LOC103694479X3758652037588347Rat
7650146LOC102555294ubiquitin-like protein 4A-likeX3772863937729454Rat
620904Sh3kbp1SH3 domain-containing kinase-binding protein 1X3779000438196365Rat
1562161Bclaf3BCLAF1 and THRAP3 family member 3X3829400938353525Rat
2320481LOC100361282ribosomal protein S9-likeX3837134738384351Rat
1564852Map7d2MAP7 domain containing 2X3840057838467825Rat
7550250LOC102546402heat shock protein HSP 90-beta-likeX3857504238578758Rat
11371832LOC10834921940S ribosomal protein S6 pseudogeneX3858208438582850Rat
9407621LOC103690825uncharacterized LOC103690825X3863123638636215Rat
9434873LOC103690826uncharacterized LOC103690826X3876180438763283Rat
1563991RGD1563991similar to TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factorX3879862038800418Rat
1584769LOC679773similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)X3885407738854940Rat
2320115LOC100361450hypothetical LOC100361450X3895269138953645Rat
1590739LOC679218similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II)X3915416439154762Rat
1583667LOC679821similar to expressed in non-metastatic cells 1, protein (NM23A) (nucleoside diphosphate kinase)X3938320139387739Rat
708454Cnksr2connector enhancer of kinase suppressor of Ras 2X3971100139953860Rat
1560439Klhl34kelch-like family member 34X3995257639956856Rat
69233Smpxsmall muscle protein, X-linkedX4002920040086870Rat
2319767LOC100361604hypothetical LOC100361604X4011901940119635Rat
1566171Mbtps2membrane-bound transcription factor peptidase, site 2X4025893340309047Rat
2324567Yy2YY2 transcription factorX4028592340289545Rat
9252019LOC103690828uncharacterized LOC103690828X4031746940322110Rat
1564826Smsspermine synthaseX4036364640415110Rat
3323Phexphosphate regulating endopeptidase homolog, X-linkedX4046004740717982Rat
9362363LOC103694483fructose-bisphosphate aldolase A pseudogeneX4050938640519141Rat
1562090RGD1562090similar to cDNA sequence BC023488X4147013541470933Rat
9433700LOC103690830uncharacterized LOC103690830X4216095842268101Rat
9429714LOC103690829uncharacterized LOC103690829X4221164742218922Rat
2319146LOC100361934NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4X4232878942329266Rat
1594528LOC317516similar to enthoprotinX4243274842436137Rat
2319724LOC100361649hypothetical LOC100361649X4243765342439403Rat
9427708LOC10369083160S ribosomal protein L34 pseudogeneX4255381942554290Rat
1564527Ptchd1patched domain containing 1X4255891242610430Rat
9389965LOC103694484serine protease inhibitor Kazal-type 11-likeX4269765242705152Rat
11466718LOC108353288glyceraldehyde-3-phosphate dehydrogenase pseudogeneX4274526142746378Rat
9421617LOC103690600serine protease inhibitor Kazal-type 11-likeX4282739042844983Rat
11436965LOC108353289glyceraldehyde-3-phosphate dehydrogenase pseudogeneX4292425542925372Rat
1559536RGD1559536similar to vitellogenin-like 1 precursorX4295123742954609Rat
1303338Spink6serine peptidase inhibitor, Kazal type 6X4303306643044975Rat
1565778Magea8MAGE family member A8X4317200143184700Rat
1586173LOC302647similar to THUMP domain containing 3X4321220443213836Rat
1583773LOC367801similar to sequestosome 1 isoform 1X4326863943269848Rat
1595434LOC680190hypothetical protein LOC680190X4328963143294392Rat
1566060RGD1566060similar to Magea5X4329849743310965Rat
620043Prdx4peroxiredoxin 4X4349545343512994Rat
7505527LOC102557137E3 ubiquitin-protein ligase RNF168-likeX4353493943538333Rat
1359188Acot9acyl-CoA thioesterase 9X4354306943592200Rat
9227212LOC10369448560S ribosomal protein L7 pseudogeneX4361524943616006Rat
1586174Sat1spermidine/spermine N1-acetyl transferase 1X4362648043629767Rat
6490802LOC10091174160S acidic ribosomal protein P0-likeX4366442143665016Rat
2318711LOC100362173rCG36365-likeX4371312843746425Rat
1592987Cldn34bclaudin 34BX4378071243786767Rat
1560334Myl6bmyosin light chain 6BX4383177843833044Rat
1592959Cldn34dclaudin 34DX4387040243878881Rat
1549733LOC317456hypothetical LOC317456X4388124643882204Rat
7558343LOC102556957uncharacterized LOC102556957X4391073043915292Rat
11406874LOC10834916660S ribosomal protein L35a pseudogeneX4409170344092057Rat
1596005LOC691709similar to ribosomal protein L7-like 1X4415772444158535Rat
1592936LOC680393similar to ribosomal protein S24X4430167044305177Rat
7651318LOC10255729360S ribosomal protein L17-likeX4446351344464087Rat
1562775RGD1562775similar to SNARE protein Ykt6X4450385644601823Rat
1565651RGD1565651similar to ferritin light chain - mouseX4477572544776294Rat
9217806LOC103690854centromere protein W-likeX4485760244861227Rat
1563868Tbl1xtransducin (beta)-like 1 X-linkedX4495988344988551Rat
1591711Cldn34eclaudin 34EX4499948245006621Rat
1590655LOC680505similar to BCL2/adenovirus E1B 19kDa-interacting protein 3-likeX4503976645040693Rat
1564076Prkxprotein kinase, X-linkedX4508096345125095Rat
7701950LOC102553584uncharacterized LOC102553584X4513688045174038Rat
708571PbsnprobasinX4517194445187189Rat
11461170LOC108348181odorant-binding protein-likeX4528211845285218Rat
2318914LOC100362067hypothetical protein LOC100362067X4537005845372843Rat
1359350Ptges3l1prostaglandin E synthase 3-like 1X4541054545419817Rat
3783Stssteroid sulfataseX4542041845428748Rat
1562200Pnpla4patatin like phospholipase domain containing 4X4551940645522988Rat
2318766LOC100362117protein tyrosine phosphatase type IVA, member 1-likeX4554768645548320Rat
1589414LOC680662similar to prostaglandin E receptor 2, subtype EP2X4555173845559154Rat
1563234RGD1563234similar to prostaglandin D receptorX4557799245585459Rat
6502369LOC100909677uncharacterized LOC100909677X4561486445616428Rat
1563378RGD1563378similar to ferritin heavy polypeptide-like 17X4563575145640012Rat
1561320Prrg1proline rich and Gla domain 1X4569824045806238Rat
1583772LOC367811similar to -Tubulin at 60D CG3401-PAX4583260045833917Rat
1588217LOC680749similar to ring finger protein 41X4588487745886360Rat
1588206LOC680760hypothetical protein LOC680760X4592229945932403Rat
11403232LOC108349167glyceraldehyde-3-phosphate dehydrogenase pseudogeneX4595811545959043Rat
2324262Fam47afamily with sequence similarity 47, member AX4596525845966930Rat
9474148LOC103690856ubiquitin-conjugating enzyme E2 L3-likeX4623244746312561Rat
1587070Cfap47cilia and flagella associated protein 47X4679197646903351Rat
1562365Mageb16MAGE family member B16X4697765547026377Rat
7673906LOC102549731uncharacterized LOC102549731X4746590247470384Rat
1587019LOC680864similar to ribosomal protein L10X4788349947884235Rat
11364646LOC10834912460S ribosomal protein L10-likeX4792348647990176Rat
2324132LOC100362726prohibitin 2-likeX4808369348084346Rat
1583771LOC367812similar to Sphingosine kinase 2 (SK 2) (SPK 2)X4813133548133282Rat
11081208Da2-19uncharacterized LOC302729X4819678948213506Rat
1560892RGD1560892similar to nuclear autoantigenic sperm proteinX4823849548239850Rat
1564799Tmem47transmembrane protein 47X4877911048805644Rat
2321886Cpxcr1CPX chromosome region, candidate 1X4924327349244985Rat
7513586LOC102550193SNF-related serine/threonine-protein kinase-likeX4928343649285089Rat
1583756LOC367880hypothetical gene supported by NM_138833X4940393049405092Rat
1563383Srsf8serine and arginine rich splicing factor 8X4952952549530166Rat
1563383Srsf8serine and arginine rich splicing factor 8X4964497349705870Rat
9081779LOC103690857igE-binding protein-likeX4969811549708697Rat
1585803LOC680986similar to 4F2 cell-surface antigen heavy chain (4F2hc)X5034055250344823Rat
7692085LOC102548478uncharacterized LOC102548478X5059906050610743Rat
9161312LOC103690833sulfiredoxin-1 pseudogeneX5062900550630655Rat
6496590LOC100910782pecanex-like protein 1-likeX5064588650647060Rat
7745286LOC10255057860S ribosomal protein L9-likeX5072455250725450Rat
9319790LOC103690834uncharacterized LOC103690834X5103491651038895Rat
9078008LOC103690835centrin-2 pseudogeneX5110333051105849Rat
11492073LOC108349157centrin-2 pseudogeneX5110456751105221Rat
2507DmddystrophinX5114935853519271Rat
7631515LOC10255119560S ribosomal protein L5-likeX5127752651278362Rat
7584646LOC102549123A/G-specific adenine DNA glycosylase-likeX5132630051327556Rat
11458045LOC108349159uncharacterized LOC108349159X5135764051367181Rat
9131259LOC103690859histone H2A.V-likeX5141861451422892Rat
11387821LOC108349158uncharacterized LOC108349158X5145041151468039Rat
7619813LOC102549011titin-likeX5179144251794701Rat
1589455Bnip3l-ps1BCL2/adenovirus E1B interacting protein 3-like, pseudogene 1X5209779152098720Rat
7654529LOC102548927high mobility group protein B4-likeX5323404353235377Rat
1584678Fthl17eferritin, heavy polypeptide-like 17, member EX5362894653629936Rat
1584654LOC681090similar to Xanthine dehydrogenase/oxidaseX5391685854014111Rat
1594527Tab3TGF-beta activated kinase 1 (MAP3K7) binding protein 3X5403595854090282Rat
70893Gkglycerol kinaseX5422729154303897Rat
2324603LOC100363193LRRGT00076-likeX5426668754295766Rat
9253231LOC103690840uncharacterized LOC103690840X5430394054340998Rat
11492655LOC108349125replication protein A 14 kDa subunit pseudogeneX5433255154333573Rat
1565785TaslTLR adaptor interacting with endolysosomal SLC15A4X5439073354409466Rat
1583524Samt3spermatogenesis associated multipass transmembrane protein 3X5455387054556708Rat
62028Nr0b1nuclear receptor subfamily 0, group B, member 1X5473438554738513Rat
1560904Mageb2MAGE family member B2X5480702454811144Rat
1562343Mageb3MAGE family member B3X5484320254844197Rat
1562439Mageb1l1MAGE family member B1-like 1X5486444154931190Rat
1565746Mageb1MAGE family member B1X5489248254931144Rat
1563904Mageb7MAGE family member B7X5493847054941813Rat
1560330RGD1560330similar to LRRGT00057X5511359655114294Rat
727891Il1rapl1interleukin 1 receptor accessory protein-like 1X5543938857004865Rat
1587059LOC680824similar to Proteasome subunit beta type 3 (Proteasome theta chain) (Proteasome chain 13) (Proteasome component C10-II)X5563544155636130Rat
9172033LOC103690842uncharacterized LOC103690842X5687281356874542Rat
7560377LOC102555915uncharacterized LOC102555915X5687641656880290Rat
1583769LOC367821similar to GDP dissociation inhibitor 2X5718636357187684Rat
1565286RGD1565286similar to ribosomal protein L5X5771503357715926Rat
1559817Ppp4r3cprotein phosphatase 4 regulatory subunit 3CX5786639157872247Rat
1596708LOC681382hypothetical protein LOC681382X5799569357996013Rat
2323776LOC100362917hypothetical LOC100362917X5851830658519797Rat
1584985Dcaf8l1DDB1 and CUL4 associated factor 8-like 1X5856430558566841Rat
11419092LOC108349128actin-2-likeX5858276858583474Rat
2322797LOC100363551hypothetical LOC100363551X5859468458595351Rat
1584987LOC302759similar to muscle protein684X5866806958668750Rat
9431964LOC103690860melanoma-associated antigen B4-likeX5875482158755552Rat
2321601LOC100364157hypothetical LOC100364157X5880436558805244Rat
1584369LOC684991similar to FGF receptor activating protein 1X5882377558825858Rat
1563978RGD1563978similar to mKIAA1387 proteinX5904103859152525Rat
11361899LOC108353265igE-binding protein-likeX5918715359192172Rat
6503220LOC100909486putative SMEK homolog 3-likeX5927584559277519Rat
7540144LOC102546520uncharacterized LOC102546520X5933793459342935Rat
9431453LOC103690861iron-sulfur cluster assembly 1 homolog, mitochondrial pseudogeneX5959106059597097Rat
2321433LOC100364225hypothetical LOC100364225X5972310559724612Rat
1565939RGD1565939similar to Expressed sequence AW011752X6013594260138286Rat
7702864LOC102549323uncharacterized LOC102549323X6026453760265038Rat
1583220LOC685083similar to Y17G7B.10bX6029151660293727Rat
1585830LOC680959similar to 60S ribosomal protein L32X6039178160392218Rat
2324718LOC100363172fumarate hydratase-likeX6045841260459733Rat
1594017LOC682831similar to melanoma antigen family B, 3X6055122960552367Rat
1563554RGD1563554similar to MGC79482 proteinX6076150760764267Rat
1563078Mageb5MAGE family member B5X6084900560852583Rat
1565662Mageb6MAGE family member B6X6086337260864521Rat
1588564LOC302439similar to Pyruvate kinase isozyme M2X6092957360931207Rat
1559523Magebl1MAGE family member B-like 1X6093926060942845Rat
1560325RGD1560325similar to Tubulin, beta 6X6094143560953942Rat
1563590RGD1563590similar to melanoma antigen 2X6098951260996329Rat
1564443MGC114483similar to MAGEB3X6102718661104643Rat
1561997Mageb4MAGE family member B4X6110303161151601Rat
1559970RGD1559970similar to melanoma antigen 2X6120566061206502Rat
1561382RGD1561382similar to Smage-1 proteinX6121533161216539Rat
1560369Mageb18MAGE family member B18X6122983161232133Rat
11362609LOC108349222uncharacterized LOC108349222X6167071861815532Rat
1595135LOC685313similar to eukaryotic translation initiation factor 4BX6191875061919994Rat
2322817LOC100363530hypothetical LOC100363530X6203514762047042Rat
7609486LOC102551429uncharacterized LOC102551429X6217044762318636Rat
1562672Arxaristaless related homeoboxX6236375762376139Rat
621816Pola1DNA polymerase alpha 1, catalytic subunitX6238260462698830Rat
11508574LOC108349223zinc transporter 9 pseudogeneX6251178462521982Rat
7666182LOC102551494zinc transporter 9-likeX6251802762520604Rat
708434Pcyt1bphosphate cytidylyltransferase 1B, cholineX6272769162821199Rat
11403019LOC108349224ribosome biogenesis protein NSA2 homologX6274233262745981Rat
1593276Pdk3pyruvate dehydrogenase kinase 3X6283613162904114Rat
1589276LOC683205hypothetical protein LOC683205X6295909262959934Rat
1593786LOC685471similar to 2,4-dienoyl CoA reductase 1, mitochondrialX6297685362979845Rat
1565951Fam48b1family with sequence similarity 48, member B1X6300032263006722Rat
11400519LOC108353266suprabasin-likeX6300420563006432Rat
2323249LOC100359894hypothetical LOC100359894X6303118663031671Rat
1564534RGD1564534similar to CHCHD4 proteinX6305303163059164Rat
1563909LOC367830similar to FAM48A proteinX6306495063115272Rat
9396441LOC10369086214-3-3 protein sigma-likeX6310206363106317Rat
7551563LOC102554251ubiquitin-conjugating enzyme E2 variant 1-likeX6310756563108065Rat
11516141LOC108349130small nuclear ribonucleoprotein F-likeX6311271963113009Rat
1562664Zfxzinc finger protein X-linkedX6315836863204971Rat
1561279Eif2s3eukaryotic translation initiation factor 2 subunit gammaX6326810663291125Rat
1566100RGD1566100similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)X6332935563333352Rat
1563101Klhl15kelch-like family member 15X6334227763390915Rat
6494769LOC100911168kelch-like protein 15-likeX6339220963397468Rat
1591335LOC685678similar to solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21X6343129363432176Rat
11453342LOC108349169glyceraldehyde-3-phosphate dehydrogenase-likeX6343910263440163Rat
1590267LOC685700hypothetical protein LOC685700X6345234563520836Rat
1565289Apooapolipoprotein OX6352103363625134Rat
7616550LOC102556301RWD domain-containing protein 4-likeX6353822963539244Rat
7733257LOC102556393uncharacterized LOC102556393X6363109763656994Rat
11375853LOC108349225uncharacterized LOC108349225X6365807263665457Rat
1563322RGD1563322similar to heat shock protein 1, betaX6368292063684683Rat
1590231LOC685737similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X6369147763692530Rat
2322893LOC100360052splicing factor, arginine/serine-rich 10-likeX6369970763700414Rat
70898Maged1MAGE family member D1X6380319463809715Rat
2322848Gpx2-ps2glutathione peroxidase 2, pseudogene 2X6382078663824748Rat
7539044LOC10254652160S ribosomal protein L15-likeX6382082063821427Rat
9476443LOC103694487protein gar2-likeX6389738863898284Rat
1563213Gspt2G1 to S phase transition 2X6395913163961652Rat
1589066LOC685820similar to queuine tRNA-ribosyltransferase domain containing 1X6398402963985373Rat
7692727LOC102546630protein gar2-likeX6399881363999664Rat
1565657RGD1565657similar to germ cell-lessX6403467064036266Rat
1563355Zxdbzinc finger, X-linked, duplicated BX6409260964097967Rat
11432872LOC10834917040S ribosomal protein S10 pseudogeneX6418208964182629Rat
1564004Spin4spindlin family, member 4X6421707464221225Rat
620719Arhgef9Cdc42 guanine nucleotide exchange factor 9X6424957664428444Rat
2322260LOC100360393hypothetical LOC100360393X6450657764507748Rat
1587824LOC685950similar to Mitochondrial carrier protein CGI-69X6452801764529187Rat
1565054RGD1565054similar to 60S acidic ribosomal protein P1X6467621364679280Rat
1560322Amer1APC membrane recruitment protein 1X6468662064702504Rat
1561142Asb12ankyrin repeat and SOCS box-containing 12X6471433764800662Rat
1584810LOC679731hypothetical protein LOC679731X6472142264722660Rat
7682302LOC10255026240S ribosomal protein SA-likeX6480028264801197Rat
1561708Zc4h2zinc finger C4H2-type containingX6488797864908682Rat
1588547LOC314123similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)X6491389664915954Rat
1586617LOC686079similar to discs, large homolog-associated protein 4X6501239565016649Rat
1560891Zc3h12bzinc finger CCCH-type containing 12BX6504003265074857Rat
1565755Las1lLAS1-like, ribosome biogenesis factorX6508159165102344Rat
7570644LOC102550969uncharacterized LOC102550969X6510655065112159Rat
621260MsnmoesinX6522683465294192Rat
7626838LOC102551035serine/arginine repetitive matrix protein 4-likeX6533531665336069Rat
2325543Mir223microRNA 223X6536781265367921Rat
1564659Vsig4V-set and immunoglobulin domain containing 4X6537085165400298Rat
71060HephhephaestinX6537731365658479Rat
2321468LOC100360790heat shock transcription factor 3X6541224165468572Rat
9234313LOC103690847ubiquitin-like protein ATG12 pseudogeneX6546185665463737Rat
2321327LOC100360831hypothetical LOC100360831X6555677065558142Rat
11467816LOC108349226CDGSH iron-sulfur domain-containing protein 3, mitochondrial-likeX6555753365558148Rat
9232671LOC10369084660 kDa heat shock protein, mitochondrial pseudogeneX6563673465641849Rat
1564566Gpr165G protein-coupled receptor 165X6579635965802144Rat
1562685Pgr15lG protein-coupled receptor 15-likeX6631441666319928Rat
11504987LOC108349228uncharacterized LOC108349228X6641225966434239Rat
11380413LOC108349227glyceraldehyde-3-phosphate dehydrogenase pseudogeneX6647408466475078Rat
1561086Rpl34l1ribosomal protein L34-like1X6650060466500967Rat
1565058RGD1565058similar to RIKEN cDNA 1700019M22X6651592866516694Rat
1564025Eda2rectodysplasin A2 receptorX6656020066602509Rat
1583766LOC367842similar to eukaryotic translation termination factor 1X6666720166668735Rat
1587609LOC688570similar to butyrate-induced transcript 1X6683689066847667Rat
1561658RGD1561658similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)X6721055167212559Rat
7509912LOC102551431profilin-2-likeX6729439567294787Rat
2322061LOC100360495hypothetical LOC100360495X6736190967362171Rat
1586626LOC686070similar to Alpha- and gamma-adaptin-binding protein p34X6738601267387060Rat
2147Arandrogen receptorX6765625367828998Rat
1593274LOC296875similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)X6798031567981646Rat
2320547LOC100361216deoxycytidylate deaminase-likeX6808869568118056Rat
1563435Ophn1oligophrenin 1X6818586568579518Rat
11489255LOC10834910860S ribosomal protein L7 pseudogeneX6839015168409280Rat
7722908LOC102555363transcription factor Sp3-likeX6846769868471989Rat
7740156LOC102551847uncharacterized LOC102551847X6847367368481194Rat
1597149LOC312111similar to prohibitinX6858092268585216Rat
1566154Yipf6Yip1 domain family, member 6X6862576068637780Rat
1560770Stard8StAR-related lipid transfer domain containing 8X6871315768785046Rat
7678081LOC102555722ER membrane protein complex subunit 7-likeX6878398368787651Rat
1585233LOC688775similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)X6887382968877240Rat
2540Efnb1ephrin B1X6889122768904034Rat
4888534Mir3573microRNA 3573X6889297268893043Rat
1585224Rpl27-l1ribosomal protein L27-like 1X6895502568955506Rat
11450976LOC108349229uncharacterized LOC108349229X6920705669209244Rat
1591532Pja1praja ring finger ubiquitin ligase 1X6921364569218601Rat
2320274LOC100361391hypothetical LOC100361391X6955812169559620Rat
1584125Nalf2NALCN channel auxiliary factor 2X6957996869605032Rat
11442080LOC10834923060S ribosomal protein L29 pseudogeneX6971738669717914Rat
1563178Edaectodysplasin-AX6973012370222693Rat
9457454LOC103690848developmental pluripotency-associated protein 4-likeX6974197069747095Rat
9685079Mir676microRNA 676X7020701570207103Rat
1565111Awat2acyl-CoA wax alcohol acyltransferase 2X7022476170233021Rat
11373169LOC108349231glyceraldehyde-3-phosphate dehydrogenase pseudogeneX7023401770235241Rat
1560855Otud6aOTU deubiquitinase 6AX7025629970257746Rat
11365249LOC108349172zinc finger protein 431-likeX7031160570312055Rat
62011Igbp1immunoglobulin binding protein 1X7032276470345005Rat
1596935Dgat2l6diacylglycerol O-acyltransferase 2-like 6X7035435770377887Rat
1587163Awat1acyl-CoA wax alcohol acyltransferase 1X7040812470414369Rat
61798P2ry4pyrimidinergic receptor P2Y4X7042159970447109Rat
621385Arr3arrestin 3X7043859070452140Rat
1560007Pdzd11PDZ domain containing 11X7045860170461635Rat
620526Kif4akinesin family member 4AX7046170070561084Rat
11416999Trnaf-gaa8transfer RNA phenylalanine (anticodon GAA) 8X7055608170556154Rat
1560780Gdpd2glycerophosphodiester phosphodiesterase domain containing 2X7056338170572295Rat
68423Dlg3discs large MAGUK scaffold protein 3X7059624670648529Rat
1560239Tex11testis expressed 11X7067021270946621Rat
2318376LOC100362309glutamyl-tRNA(Gln) amidotransferase, subunit C homologX7092875570929340Rat
68342Slc7a3solute carrier family 7 member 3X7097276770979466Rat
1565585Snx12sorting nexin 12X7098982271127330Rat
7537941LOC10254841440S ribosomal protein S2-likeX7104278871043807Rat
9134973LOC103690849uncharacterized LOC103690849X7104796171051416Rat
7640555LOC102548326uncharacterized LOC102548326X7112752971142020Rat
1561201Foxo4forkhead box O4X7115528471162158Rat
9078783CXHXorf65chromosome X open reading frame, human CXorf65X7116200671165279Rat
621466Il2rginterleukin 2 receptor subunit gammaX7116537871169078Rat
1585896Med12mediator complex subunit 12X7117465371197812Rat
621119Nlgn3neuroligin 3X7119939071227460Rat
61926Gjb1gap junction protein, beta 1X7127203071279973Rat
1564967Zmym3zinc finger MYM-type containing 3X7129873771313529Rat
1549738Nononon-POU domain containing, octamer-bindingX7132436571342225Rat
1565015Itgb1bp2integrin subunit beta 1 binding protein 2X7134277071347623Rat
1562050Taf1TATA-box binding protein associated factor 1X7141229171486456Rat
62060OgtO-linked N-acetylglucosamine (GlcNAc) transferaseX7154087071585906Rat
9094000LOC10369085160S ribosomal protein L35a pseudogeneX7157628171576659Rat
7634291LOC102548506retinitis pigmentosa 1-like 1 protein-likeX7158921871603453Rat
9238122LOC103690864vegetative cell wall protein gp1-likeX7159014171592039Rat
621528Cxcr3C-X-C motif chemokine receptor 3X7161434671616997Rat
7709969LOC10254878740S ribosomal protein S19-likeX7164821471648618Rat
2320498LOC100361265rCG64283-likeX7167681071681062Rat
7751972LOC102553785uncharacterized LOC102553785X7168126471685432Rat
7628812LOC102555994uncharacterized LOC102555994X7171033271712522Rat
1564117Nhsl2NHS-like 2X7189520271980019Rat
6490575Rtl5retrotransposon Gag like 5X7195644671961013Rat
1590326Pin4peptidylprolyl cis/trans isomerase, NIMA-interacting 4X7200441372011667Rat
1565734Ercc6lERCC excision repair 6 like, spindle assembly checkpoint helicaseX7201837372034140Rat
1583602LOC679888similar to small nuclear ribonucleoprotein D2X7205659872060180Rat
2324318Rps4xribosomal protein S4, X-linkedX7207410872078551Rat
620781Cited1Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1X7212899672133692Rat
1562895Hdac8histone deacetylase 8X7216377772370058Rat
7714589LOC102554661uncharacterized LOC102554661X7230425372344468Rat
7693748LOC102554565uncharacterized LOC102554565X7234447472375379Rat
621522Phka1phosphorylase kinase regulatory subunit alpha 1X7237702072515385Rat
1598110LOC679960similar to kelch domain containing 2X7244858372450138Rat
9854661Rps27a-ps3ribosomal protein S27a, pseudogene 3X7245633872456877Rat
11396517LOC108349132high mobility group protein B1-likeX7256162472607449Rat
1598072LOC679999similar to TGF beta-inducible nuclear protein 1 (L-name-related protein 42) (LNR42)X7261133772612165Rat
6488545LOC100912113ribosome biogenesis protein NSA2 homologX7261764972618872Rat
11451771Dmrtc1aDMRT-like family C1aX7262466072654258Rat
1596863LOC680024similar to spindlinX7267641172677422Rat
1359563Dmrtc1c1DMRT-like family C1c1X7268431572691535Rat
7530633LOC102556425transcription initiation factor TFIID subunit 1-likeX7272285072725478Rat
11377842LOC108353292uncharacterized LOC108353292X7274185372779621Rat
11402730LOC108353291uncharacterized LOC108353291X7280456572853510Rat
11359079LOC108353290histone deacetylase 8-likeX7285386772863197Rat
1584423LOC684932similar to Zinc finger protein 75X7290656572912322Rat
1590178LOC685790similar to Protein CXorf48 (Tumor antigen BJ-HCC-20)X7298345672991377Rat
2322505LOC100360246hypothetical LOC100360246X7299228172995520Rat
1563270RGD1563270similar to synaptonemal complex protein 3X7300195573015999Rat
9310038LOC103690722synaptonemal complex protein 3-likeX7304023973044223Rat
7585937LOC102547119spermatogenesis-associated protein 31C2-likeX7308342373086066Rat
1588387LOC501389similar to chromosome 9 open reading frame 36X7308607873087692Rat
9232327LOC103694490uncharacterized LOC103694490X7319716273208271Rat
11491560LOC108353293uncharacterized LOC108353293X7319945073204005Rat
2322455LOC100360296BRCA2-interacting protein-likeX7328875573360235Rat
7641681LOC102549487uncharacterized LOC102549487X7330540573306394Rat
1584453Zfp449zinc finger protein 449X7339088573413939Rat
9296500LOC103694491uncharacterized protein MGC39606 homologX7342477473428713Rat
1564845RGD1564845similar to Xlr-likeX7345499373467444Rat
1559581Zfp36l3zinc finger protein 36, C3H type-like 3X7347489473478223Rat
11444048LOC108349174heterogeneous nuclear ribonucleoprotein A1 pseudogeneX7348061573481862Rat
2322060Fam9bfamily with sequence similarity 9, member BX7349667473509023Rat
1560456Ct55cancer/testis antigen 55X7351283573525680Rat
7724551LOC102550394uncharacterized LOC102550394X7353316173552577Rat
6498758LOC100910451uncharacterized LOC100910451X7355723173564570Rat
2322617LOC100363632hypothetical LOC100363632X7357986373580648Rat
1595540Rtl8bretrotransposon Gag like 8BX7358131773582226Rat
2322607LOC100363642coiled-coil domain-containing protein 41-likeX7358516573602409Rat
1593086Rtl8aretrotransposon Gag like 8AX7361637173617584Rat
9186921LOC103694492uncharacterized LOC103694492X7365891473659375Rat
1596820Dmrtc1bDMRT-like family C1bX7366385973691856Rat
6497321LOC100910646E3 ubiquitin-protein ligase RLIM-likeX7375766473778757Rat
1559832Rlimring finger protein, LIM domain interactingX7375766473778763Rat
9286705LOC103690100small nuclear ribonucleoprotein G pseudogeneX7379023773790551Rat
1566061RGD1566061similar to 40S ribosomal protein S7 (S8)X7380791473808500Rat
1566367Pabpc1l2apoly(A) binding protein, cytoplasmic 1-like 2AX7389460373895742Rat
6493448LOC100911328ribosome biogenesis protein NSA2 homologX7397666673977491Rat
1583763LOC367856similar to DNA methyltransferase 1-associated protein 1X7398752373989068Rat
1563260Nap1l2nucleosome assembly protein 1-like 2X7399727473999677Rat
1562521RGD1562521similar to PpnxX7401037574048818Rat
9380713LOC10369086660S ribosomal protein L18a pseudogeneX7401770374018456Rat
2319702LOC100361671HIG1 domain family, member 1A-likeX7405736774057984Rat
11383020LOC108353294endogenous retrovirus group K member 6 Pol protein-likeX7410646774107740Rat
11467028LOC108353267endogenous retrovirus group K member 25 Pol protein-likeX7410788074109485Rat
11500327LOC108349232endogenous retrovirus group K member 6 Gag polyprotein-likeX7410954874197042Rat
1561529Cdx4caudal type homeo box 4X7416517274173758Rat
2319518LOC100361756ribosomal protein S26-likeX7418837874188724Rat
11407688LOC108353295cysteine-rich hydrophobic domain-containing protein 1 pseudogeneX7420080574201321Rat
1589722Chic1cysteine-rich hydrophobic domain 1X7420564974250613Rat
3914Tsxtestis specific X-linked geneX7426951374283819Rat
1594204LOC680227LRRGT00193X7430429274341623Rat
6492187LOC100911498uncharacterized LOC100911498X7432463774342152Rat
1583762LOC367858similar to GTPase HRas precursor (Transforming protein p21) (p21ras) (H-Ras-1) (c-H-ras)X7437129474372394Rat
1564124FtxFTX transcript, XIST regulatorX7444026574484164Rat
2325538Mir421microRNA 421X7444349274443570Rat
2325517Mir374bmicroRNA 374bX7444364874443715Rat
1589760Zcchc13zinc finger CCHC-type containing 13X7449712774498269Rat
7726681JpxJPX transcript, XIST activatorX7449944274518419Rat
1589761LOC302398hypothetical LOC302398X7453369974534705Rat
11427362LOC10834913340S ribosomal protein S2 pseudogeneX7454666974555739Rat
7715669LOC102546324RBPJ-interacting and tubulin-associated protein-likeX7455737274558230Rat
628608Slc16a2solute carrier family 16 member 2X7457860074706068Rat
1592976LOC680353similar to 60S ribosomal protein L38X7482448174824720Rat
11393862NEWGENE_1559832ring finger protein, LIM domain interactingX7483815974859561Rat
1598318LOC317240similar to splicing factor 3a, subunit 2X7493265074933771Rat
1561931Nexmifneurite extension and migration factorX7494344075053559Rat
2325441Mir672microRNA 672X7498207074982149Rat
1303086Abcb7ATP binding cassette subfamily B member 7X7515051175291950Rat
1564806Uprturacil phosphoribosyltransferase homologX7538255375408541Rat
1562075Zdhhc15zinc finger DHHC-type palmitoyltransferase 15X7543395775566531Rat
4888600Mir3559microRNA 3559X7545924175459355Rat
7570701LOC102555916uncharacterized LOC102555916X7556280775611210Rat
1594342LOC503452similar to karyopherin (importin) alpha 2X7573699975738663Rat
1564872Magee2MAGE family member E2X7573768475795206Rat
1589762LOC302393similar to ribosomal protein S8X7581643675817072Rat
6485055LOC100912991uncharacterized LOC100912991X7601031076031907Rat
1562502Pbdc1polysaccharide biosynthesis domain containing 1X7604223976092964Rat
1560259Magee1MAGE family member E1X7608355376087100Rat
9363342LOC10369086860S ribosomal protein L19 pseudogeneX7609278076095365Rat
9341032LOC103690877trafficking protein particle complex subunit 13-likeX7611459876115362Rat
9115880LOC103690869uncharacterized LOC103690869X7612795176156073Rat
1590568Cct3-ps3chaperonin containing Tcp1, subunit 3 (gamma), pseudogene 3X7627331376275150Rat
7503608LOC102547322uncharacterized LOC102547322X7628050776288729Rat
2325502Mir384microRNA 384X7630176376301845Rat
9462670LOC103690870uncharacterized LOC103690870X7632112876347370Rat
2325624Mir325microRNA 325X7633427176334368Rat
1563232RGD1563232similar to RIKEN cDNA 1700001F22X7643841176439103Rat
1560099RGD1560099similar to ribosomal protein L19X7644786876448442Rat
2318509LOC100362276mitogen-activated protein kinase 3-likeX7674543176749301Rat
1586007LOC501595similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)X7677286776773883Rat
71052Fgf16fibroblast growth factor 16X7678672876796311Rat
619795AtrxATRX, chromatin remodelerX7682011076979155Rat
9169028LOC103694493uncharacterized LOC103694493X7695754276960303Rat
1591974LOC498424similar to GC-rich promoter binding protein 1-like 1X7699727976999130Rat
620094Magt1magnesium transporter 1X7702342377061603Rat
727789Cox7bcytochrome c oxidase subunit 7BX7706542777071676Rat
2324595LOC100363531LRRGT00182-likeX7706546177081039Rat
2179Atp7aATPase copper transporting alphaX7707608577193644Rat
1562655Tlr13toll-like receptor 13X7721631277234046Rat
1587069LOC680814similar to ribosomal protein L19X7725893977259554Rat
619878Pgk1phosphoglycerate kinase 1X7726339977279373Rat
621116Taf9bTATA-box binding protein associated factor 9bX7728123477295238Rat
9446460LOC103694496protein ALEX-likeX7729519577295431Rat
2323689LOC10035950540S ribosomal protein S21-likeX7729890377299247Rat
1563846Fndc3c1fibronectin type III domain containing 3C1X7741695977559348Rat
11384519LOC10835329660S ribosomal protein L29 pseudogeneX7742584977426295Rat
9214620LOC103694495fibronectin type III domain containing protein 3C1-likeX7743090177435052Rat
6503030LOC100909565heterogeneous nuclear ribonucleoprotein A1-like 2-likeX7744107777442025Rat
1587004LOC680880similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand RNA-binding protein) (hnRNP core protein A1) (HDP)X7760073577601683Rat
1594341LOC503455similar to 60S ribosomal protein L7X7761776477618355Rat
1586006LOC501599similar to galectin 8X7765478877662173Rat
619796Cysltr1cysteinyl leukotriene receptor 1X7767102877700491Rat
2324606LOC100359656rCG38062-likeX7778656677810066Rat
2324103LOC100362755Small nuclear ribonucleoprotein-associated protein B-likeX7785509577855971Rat
1560821RGD1560821similar to small nuclear ribonucleoparticle-associated proteinX7788556277886179Rat
1564805Rtl3retrotransposon Gag like 3X7795357477957261Rat
2323925Selenok-ps6selenoprotein K, pseudogene 6X7798158377981969Rat
1563686Lpar4lysophosphatidic acid receptor 4X7804285978056347Rat
1561912P2ry10P2Y receptor family member 10X7815872978210413Rat
11478169LOC108353297uncharacterized LOC108353297X7822182478241020Rat
1560455RGD1560455similar to RIKEN cDNA A630033H20 geneX7825849578284180Rat
6500693LOC100909985prohibitin-likeX7828518478286574Rat
1564689Gpr174G protein-coupled receptor 174X7835834778399944Rat
7743291LOC102552443alpha-enolase-likeX7837943978382827Rat
1559423Itm2aintegral membrane protein 2AX7849087278496814Rat
1589763LOC302371similar to prohibitinX7856512478565997Rat
1593243LOC317618similar to TGF beta-inducible nuclear protein 1 (L-name-related protein 42) (LNR42)X7868113978681985Rat
1589764Tbx22T-box transcription factor 22X7873173878782542Rat
1583582LOC681108similar to forkhead box N2X7874652578747528Rat
11465321LOC108353298uncharacterized LOC108353298X7886138178864261Rat
1566265RGD1566265similar to RIKEN cDNA 2610002M06X7887096478911601Rat
1559589Tent5dterminal nucleotidyltransferase 5DX7891164178994467Rat
1561552RGD1561552similar to WASP family 1X7906420079066932Rat
11513555LOC108353276igE-binding protein-likeX7929874279299587Rat
11516258LOC108353268endogenous retrovirus group K member 18 Pol protein-likeX7930083979313878Rat
1563242RGD1563242similar to riboflavin kinaseX7948922479490572Rat
1562871RGD1562871similar to BMI1-like proteinX7954662479547767Rat
9098358LOC103690878syntaxin-3-likeX7974222479743117Rat
1584865LOC501602similar to peptidylprolyl isomerase DX7979955179800864Rat
1559445Brwd3bromodomain and WD repeat domain containing 3X7981796879909891Rat
6497694Hmgn5high mobility group nucleosome binding domain 5X8013455780142902Rat
1560520Sh3bgrlSH3 domain binding glutamate-rich protein likeX8021320980312393Rat
1562039RGD1562039similar to MGC82337 proteinX8033882080354928Rat
1596765LOC681325hypothetical protein LOC681325X8035955580363168Rat
7568867LOC102554698uncharacterized LOC102554698X8044066880467510Rat
2323375LOC100363265rCG21417-likeX8063787780638412Rat
7524128LOC102554937transmembrane protein 182-likeX8068406480722797Rat
1594339LOC503457similar to prohibitinX8092760180928612Rat
7717307LOC102555942igE-binding protein-likeX8107362781115037Rat
1583760LOC367871similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X8143931781440357Rat
1596697LOC681393similar to kinesin family member 18AX8161022581611434Rat
11415866LOC108353277uncharacterized LOC108353277X8164918881652768Rat
6494257LOC100911206prolactin-3D1-likeX8166440981673264Rat
1595418LOC681406similar to 40S ribosomal protein S2X8181638381817065Rat
11485613LOC10834917660S ribosomal protein L29 pseudogeneX8186592481866370Rat
7527839LOC102555876uncharacterized LOC102555876X8189070081898611Rat
61947Pou3f4POU class 3 homeobox 4X8214378982145066Rat
2323810Cylc1cylicin 1X8221713382302106Rat
1584368LOC684992similar to tropomyosin 3, gamma isoform 2X8228992282292839Rat
1303108Ankra2ankyrin repeat family A member 2X8240760182418229Rat
11422950LOC108349177glyceraldehyde-3-phosphate dehydrogenase-likeX8258926182590433Rat
11481675Trnar-ccu9transfer RNA arginine (anticodon CCU) 9X8263197182632043Rat
1560817Rps6ka6ribosomal protein S6 kinase A6X8264167982743771Rat
6493151LOC100911391pre-mRNA-splicing factor CWC22 homologX8284163582849815Rat
1563666Hdxhighly divergent homeoboxX8284789583151516Rat
9177544LOC103694497serine/arginine-rich splicing factor 10 pseudogeneX8317681683177673Rat
2321964LOC100363993testis expressed gene 16-likeX8323206583456482Rat
6491583LOC100911639uncharacterized LOC100911639X8351934683603993Rat
2323338Ube2d4l1ubiquitin-conjugating enzyme E2D 4 like 1X8356993483570924Rat
1549725Apoolapolipoprotein O-likeX8367826983750550Rat
1565932Satl1spermidine/spermine N1-acetyl transferase-like 1X8377252683788556Rat
621639Obp1fodorant binding protein I fX8384794483864150Rat
7505820LOC102549453uncharacterized LOC102549453X8384804683849071Rat
2318179LOC100362409odorant-binding protein-likeX8385989883864401Rat
6490707LOC100911846elongation factor 1-alpha 1-likeX8387721583908302Rat
1561958RGD1561958similar to RIKEN cDNA 2010106E10X8392648684014691Rat
1562768Zfp711zinc finger protein 711X8406236384095888Rat
1560798Pof1bPOF1B, actin binding proteinX8409961884167717Rat
1597720LOC685163similar to replication factor C (activator 1) 4X8416768084231025Rat
1583758LOC367876similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X8441733584418350Rat
1583757LOC367877similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-likeX8443060484431567Rat
7629268LOC102550604uncharacterized LOC102550604X8452204184530238Rat
2322911LOC100360034dim gamma-tubulin 1-likeX8465807784659651Rat
2340ChmCHM Rab escort proteinX8466690084821775Rat
2325532Mir361microRNA 361X8470891184708980Rat
1561687Dach2dachshund family transcription factor 2X8492457085484150Rat
1596455LOC685241similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)X8569534485697596Rat
1565441Klhl4kelch-like family member 4X8612592986229565Rat
9086566LOC103690871tubulin alpha-1 chain-likeX8614264786144550Rat
1596429LOC685268similar to influenza virus NS1A binding protein isoform aX8633993886341824Rat
1561582RGD1561582similar to Fus1 proteinX8645644486457014Rat
2322525LOC100360225hypothetical LOC100360225X8663038386631470Rat
1334134Olr1753-psolfactory receptor pseudogene 1753X8666115386661709Rat
1597164LOC301752similar to Zinc finger protein GLI2 (Tax helper protein)X8666857486790006Rat
7672285LOC102552367uncharacterized LOC102552367X8726223387264305Rat
1560954RGD1560954similar to beta-actinX8773068487731243Rat
6486105LOC100912627actin, cytoplasmic 1-likeX8776571387793233Rat
2321933LOC100360524Yip1 domain family, member 4-likeX8805847188068181Rat
1595060LOC685388similar to family with sequence similarity 51, member A1 homologX8807726888078039Rat
2321540LOC100360718vitamin K epoxide reductase complex subunit 1-like protein 1-likeX8829826688298651Rat
1561666H2ab3H2A.B variant histone 3X8860213588602485Rat
11409359LOC108349139ferritin light chain 1 pseudogeneX8863522688636025Rat
1584982LOC302786similar to Heat shock protein HSP 90-beta (HSP 84)X8872131488723465Rat
1591601LOC683006similar to RIKEN cDNA 1700001F22X8886105488866121Rat
1583755LOC367882similar to L-lactate dehydrogenase B chain (LDH-B) (LDH heart subunit) (LDH-H)X8912124289122506Rat
6501589LOC100909798heat shock cognate protein HSP 90-beta-likeX8957926989582660Rat
11379849LOC108349140serine/threonine-protein kinase H1-likeX8968365789684217Rat
1592556LOC685592similar to high-mobility group (nonhistone chromosomal) protein 1-like 1X9018997090190841Rat
1561826Tgif2lx2TGFB-induced factor homeobox 2-like, X-linked 2X9058801690589052Rat
1591514LOC683096similar to cactin CG1676-PAX9082332990825572Rat
9439993LOC103694500fructose-bisphosphate aldolase A-likeX9083335990840960Rat
7538242LOC102553611uncharacterized LOC102553611X9122769691232883Rat
1591359LOC685654similar to Targeting protein for Xklp2 (Restricted expression proliferation associated protein 100) (p100) (Differentially expressed in cancerous and noncancerous lung cells 2) (DIL-2) (Protein FLS353) (Hepatocellular carcinoma-associated antigen 5...X9166660891669003Rat
9310051LOC103690872ATP synthase subunit epsilon, mitochondrial-likeX9199550991995661Rat
11503216LOC108349180high mobility group protein B4-likeX9210523892105967Rat
1587661Pabpc5poly A binding protein, cytoplasmic 5X9213029292133756Rat
1583754LOC367887similar to pescadillo homolog 1, containing BRCT domainX9235063392352367Rat
11460839LOC108349181glyceraldehyde-3-phosphate dehydrogenase pseudogeneX9252527292526338Rat
11360244LOC108349237uncharacterized LOC108349237X9258879792596226Rat
1562864Pcdh11xprotocadherin 11 X-linkedX9259635593341412Rat
9458090LOC103690873late cornified envelope protein 6A-likeX9299342692994592Rat
2320944LOC100361016oocyte specific homeobox 5-likeX9306441793067181Rat
11393209LOC10834918260 kDa heat shock protein, mitochondrial pseudogeneX9343415893435147Rat
1590192LOC685776similar to interferon stimulated exonuclease gene 20-like 2X9352914993530573Rat
7729454LOC102554850uncharacterized LOC102554850X9364688693650753Rat
7514621LOC102557190igE-binding protein-likeX9365573493656619Rat
1583753LOC367889similar to zinc finger CCCH type containing 11AX9387451393933298Rat
7723107LOC102557229igE-binding protein-likeX9400039394001168Rat
1589048LOC685838hypothetical protein LOC685838X9422386394225122Rat
7645029LOC102555031igE-binding protein-likeX9445296394454202Rat
620990Nap1l3nucleosome assembly protein 1-like 3X9505933495062132Rat
9153529Fam133afamily with sequence similarity 133, member AX9506211995235281Rat
1333106Olr10olfactory receptor 10X9534482595345772Rat
1334373Olr11olfactory receptor 11X9535239795353344Rat
1641977Vom2r-ps64vomeronasal 2 receptor, pseudogene 64X9544073595441640Rat
7739373LOC102555943igE-binding protein-likeX9556254895566812Rat
7559699LOC102555573josephin-1-likeX9570916995710335Rat
9351694LOC103694499uncharacterized LOC103694499X9595863295968790Rat
1559460RGD1559460similar to hypothetical protein 4932411N23X9638714796396592Rat
1562485RGD1562485similar to RIKEN cDNA 4921511C20 geneX9645891096490181Rat
1563104RGD1563104similar to Vigilin (High density lipoprotein-binding protein)X9652883696532588Rat
1561151RGD1561151similar to hypothetical protein 4932411N23X9666841596670896Rat
7599539LOC102555852E3 ubiquitin-protein ligase RING2-likeX9672556596754847Rat
11362919LOC108353269Ig kappa chain V-II region 26-10-likeX9682227696823179Rat
9438141LOC103690610Ig kappa chain V-V region L6-likeX9691105596914408Rat
1561230RGD1561230similar to RIKEN cDNA 4921511C20 geneX9705731597076787Rat
1583752LOC367892similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1X9719921897202309Rat
2320143Cldn34c4claudin 34C4X9726132697266967Rat
7711259LOC102546672uncharacterized LOC102546672X9776092097766273Rat
11413343LOC108353270uncharacterized LOC108353270X9776232797765790Rat
11442345LOC108353271MLV-related proviral Env polyprotein-likeX9776585897767837Rat
11391315LOC108353278endogenous retrovirus group K member 8 Pol protein-likeX9808130198083646Rat
1562219Rbm31yRNA binding motif 31, Y-linkedX9809358998095725Rat
11400154LOC108349184glyceraldehyde-3-phosphate dehydrogenase pseudogeneX9903773199038732Rat
11465642LOC108349185endogenous retrovirus group K member 9 Pol protein-likeX9904949799050163Rat
1565129RGD1565129similar to DNA segment, Chr 5, ERATO Doi 577, expressedX9925051699251961Rat
1561318RGD1561318similar to SET domain-containing proteinX9938913899395608Rat
1583751LOC367895similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X9943178099432817Rat
1588872Rpl31l1ribosomal protein L31-like 1X9952273199528361Rat
1564399Diaph2diaphanous-related formin 2X99722910100363228Rat
9178920LOC103690875replication protein A 30 kDa subunit-likeX9985444799855842Rat
9245974LOC103694501uncharacterized LOC103694501X100057088100069009Rat
9077415LOC103690880high mobility group protein B4-likeX100207585100262202Rat
9339258LOC103690874protein diaphanous homolog 2-likeX100265755100510403Rat
7742870LOC102549488uncharacterized LOC102549488X100576986100627650Rat
1565648RGD1565648similar to Chain A, Solution Structure Of Rabbit Apo-S100a11 (19 Models)X100620669100622369Rat
7524436LOC102549291zinc finger protein 120-likeX100631170100640951Rat
2320731LOC100361129small nuclear ribonucleoprotein polypeptide G-likeX100668680100669051Rat
7668172LOC102549799MLV-related proviral Env polyprotein-likeX100802193100807486Rat
11430852LOC108349143igE-binding protein-likeX100971467100977931Rat
1587678LOC688501similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)X101844776101885640Rat
7684848LOC102549982high mobility group protein B4-likeX102031957102038049Rat
11373867LOC108349144high mobility group protein B4-likeX102035573102039260Rat
7566877LOC102550079high mobility group protein B4-likeX102039009102039530Rat
7737415LOC102550165high mobility group protein B4-likeX102042868102043402Rat
1583351LOC683743similar to Alpha-adducin (Erythrocyte adducin alpha subunit)X102426404102498003Rat
1587640LOC688539similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase)X102509018102510109Rat
6489364LOC100912010fructose-bisphosphate aldolase A-likeX102563632102564219Rat
9854646Rps27a-ps4ribosomal protein S27a, pseudogene 4X104255174104255702Rat
1586436LOC688664similar to Heat shock protein HSP 90-beta (HSP 84) (Tumor-specific transplantation 84 kDa antigen) (TSTA)X104288065104329046Rat
1565392Pcdh19protocadherin 19X104387346104493914Rat
620938TnmdtenomodulinX104684676104700173Rat
1560160Tspan6tetraspanin 6X104719930104729606Rat
1562444Srpx2sushi-repeat-containing protein, X-linked 2X104734035104760658Rat
620204Sytl4synaptotagmin-like 4X104763961104814152Rat
1596566Cstf2cleavage stimulation factor subunit 2X104882726104909746Rat
620598Nox1NADPH oxidase 1X104909328104932508Rat
6499811LOC10091018060S ribosomal protein L36a-likeX104932867104933495Rat
1359223XkrxXK related, X-linkedX104973083104984261Rat
7706928LOC102554368tRNA (uracil(54)-C(5))-methyltransferase homologX104988709105002359Rat
1562947Arl13aADP ribosylation factor like GTPase 13AX105010943105039720Rat
1565132Trmt2btRNA methyltransferase 2 homolog BX105056890105114876Rat
7563544LOC102555917tRNA (uracil(54)-C(5))-methyltransferase homologX105076213105081043Rat
1303093Tmem35atransmembrane protein 35AX105134498105145346Rat
2631Cenpicentromere protein IX105147045105198798Rat
621750Drp2dystrophin related protein 2X105239623105290233Rat
1564898Taf7lTATA-box binding protein associated factor 7-likeX105292338105308554Rat
621801Timm8a1translocase of inner mitochondrial membrane 8A1X105351714105355722Rat
1359683BtkBruton tyrosine kinaseX105360922105390580Rat
1306640Rpl36aribosomal protein L36aX105402867105405580Rat
1589721Glagalactosidase, alphaX105405915105417331Rat
1549784Hnrnph2heterogeneous nuclear ribonucleoprotein H2X105417603105423531Rat
1564446LOC501618LRRGT00179X105427939105433438Rat
7536858LOC102549071cytochrome c oxidase subunit 7B, mitochondrial-likeX105432129105432794Rat
2325053Armcx4armadillo repeat containing, X-linked 4X105497277105507636Rat
11424452LOC10834918640S ribosomal protein S29-likeX105530234105530484Rat
7543965LOC102554790armadillo repeat-containing X-linked protein 1-likeX105535587105539575Rat
1561629Armcx1armadillo repeat containing, X-linked 1X105535670105539575Rat
1359303Armcx6armadillo repeat containing, X-linked 6X105565733105573387Rat
1549739Armcx3armadillo repeat containing, X-linked 3X105573909105577480Rat
1359132Armcx2armadillo repeat containing, X-linked 2X105617383105622209Rat
1584778LOC679764hypothetical protein LOC679764X105624667105625302Rat
1564480RGD1564480similar to polyamine oxidase isoform 2X105651071105653230Rat
1598253LOC367905similar to transcription factor RAM2X105705612105706877Rat
1559530Nxf2nuclear RNA export factor 2X105772718105793324Rat
1565344Zmat1zinc finger, matrin-type 1X105804603105836410Rat
11441414LOC10834923960S ribosomal protein L27a-likeX105820420105821584Rat
1583638LOC679851similar to 60S ribosomal protein L18X105837953105838693Rat
11383093LOC10835327940S ribosomal protein S29-likeX105906489105906739Rat
11440590LOC108348137armadillo repeat-containing X-linked protein 1X105911839105915823Rat
1561307Pramelpreferentially expressed antigen in melanoma-likeX105937118105939860Rat
1566170Nxf7nuclear RNA export factor 7X106049075106066334Rat
1596887PramePRAME nuclear receptor transcriptional regulatorX106082984106091256Rat
1598081Tcp11x2t-complex 11 family, X-linked 2X106104501106187190Rat
2321752LOC100360605chromobox homolog 1X106202851106203507Rat
2324583LOC100361139thymosin-like 8-likeX106213233106215260Rat
1596862Nxf5nuclear RNA export factor 5X106229474106253226Rat
7586448Armcx5armadillo repeat containing, X-linked 5X106252677106255383Rat
7648445LOC102553815ras-related protein Rab-18-likeX106292560106296323Rat
621343Gprasp1G protein-coupled receptor associated sorting protein 1X106306795106313904Rat
1585932LOC679657hypothetical protein LOC679657X106341689106342520Rat
1561019Gprasp2G protein-coupled receptor associated sorting protein 2X106357240106363455Rat
1303224Bhlhb9basic helix-loop-helix family member B9X106359981106393457Rat
9167848LOC103690882uncharacterized LOC103690882X106455642106461995Rat
1563536MGC109340similar to Microsomal signal peptidase 23 kDa subunit (SPase 22 kDa subunit) (SPC22/23)X106487872106489391Rat
1595509LOC680113similar to CG6931-PAX106518320106519211Rat
2322092Arxes2adipocyte-related X-chromosome expressed sequence 2X106522900106524832Rat
1564466Bex2brain expressed X-linked 2X106556838106558366Rat
1564923Nxf3nuclear RNA export factor 3X106562957106587487Rat
1595433LOC680191similar to UPF0197 protein C11orf10 homologX106606937106636203Rat
11416069LOC108349240uncharacterized LOC108349240X106655641106667339Rat
1359631Tceal8transcription elongation factor A like 8X106713319106715391Rat
1594149Tceal5transcription elongation factor A like 5X106746456106749618Rat
1564643Bex1brain expressed, X-linked 1X106761388106771656Rat
9111695LOC103694511protein BEX1-likeX106762796106763378Rat
1593009Tceal7transcription elongation factor A like 7X106774954106777072Rat
1593001LOC680327similar to Programmed cell death protein 6 (Probable calcium-binding protein ALG-2) (PMP41) (ALG-257)X106781591106782242Rat
1592975Tceal9transcription elongation factor A like 9X106791333106794667Rat
3148Bex3brain expressed X-linked 3X106823442106825016Rat
2321901LOC100360556developmental pluripotency associated 4X106835118106835998Rat
2318936LOC100362045Psarl protein-likeX107023317107034238Rat
2320517LOC100361246presenilin associated, rhomboid-likeX107040847107052600Rat
11429483Trnaa-ugc7transfer RNA alanine (anticodon UGC) 7X107052378107052449Rat
11397795Trnaa-ugc8transfer RNA alanine (anticodon UGC) 8X107154568107154639Rat
11374985LOC108353280endogenous retrovirus group K member 8 Pol protein-likeX107185405107187748Rat
2320867LOC100361093presenilins-associated rhomboid-like protein, mitochondrial-likeX107242133107242778Rat
11490737Trnaa-ugc9transfer RNA alanine (anticodon UGC) 9X107253080107253151Rat
1562504Tceal3transcription elongation factor A like 3X107322077107324054Rat
1549724Tceal1transcription elongation factor A like 1X107370351107372347Rat
1359471Morf4l2mortality factor 4 like 2X107394468107405564Rat
7662604LOC102555540uncharacterized LOC102555540X107403271107477305Rat
1564103Glra4glycine receptor, alpha 4X107416019107447253Rat
3354Plp1proteolipid protein 1X107494326107511355Rat
1598252Gstp-ps1glutathione-S-transferase, pi type, pseudogene 1X107525629107526842Rat
1562951Rab9bRAB9B, member RAS oncogene familyX107531404107542510Rat
9462175LOC103690887late histone H2B.L4-likeX107584573107585146Rat
708373Tmsb15b2thymosin beta 15B2X107612518107614632Rat
1591860Slc25a53solute carrier family 25, member 53X107622504107632594Rat
1591868Zcchc18zinc finger, CCHC domain containing 18X107632672107633569Rat
2320208LOC100364857hypothetical LOC100364857X107636334107637947Rat
11390008LOC108349241uncharacterized LOC108349241X107664693107688918Rat
1591830Fam199xfamily with sequence similarity 199, X-linkedX107695491107723594Rat
2320172LOC100364893hypothetical LOC100364893X107738115107739419Rat
1590738Esx1ESX homeobox 1X107753614107763561Rat
2319867LOC100365002hypothetical LOC100365002X107771611107782107Rat
1590709LOC679249similar to 60S ribosomal protein L7a (Surfeit locus protein 3)X107774319107775076Rat
6486733LOC100912508TBC1 domain family member 20-likeX107782231107861674Rat
1561860RGD1561860similar to Mitochondrial processing peptidase beta subunit, mitochondrial precursor (Beta-MPP; P-52)X107892222107898270Rat
11495543LOC108349145ribosome biogenesis protein NSA2 homologX108033016108033774Rat
1590654LOC680506hypothetical protein LOC680506X108147261108149397Rat
1561761Il1rapl2interleukin 1 receptor accessory protein-like 2X108287034109851075Rat
6503244LOC100909488putative heterogeneous nuclear ribonucleoprotein A1-like 3-likeX108480396108484346Rat
1592956LOC680373similar to Ubiquitin-like protein FUBIX108523787108524510Rat
2323888Tex13atestis expressed 13AX108940741108942168Rat
9242858LOC103690883zinc finger protein ZPR1 pseudogeneX109277899109280031Rat
1596698LOC681392hypothetical protein LOC681392X109677255109683556Rat
2324088LOC100362770zinc finger, DHHC domain containing 16X109725457109726011Rat
1566163NrkNik related kinaseX109940439110036361Rat
1566163NrkNik related kinaseX110065199110089124Rat
1590596LOC680564similar to ATP-binding cassette sub-family E member 1 (RNase L inhibitor) (Ribonuclease 4 inhibitor) (RNS4I)X110139480110141001Rat
1588533LOC363500similar to UBX domain containing 4X110175220110178572Rat
619833Serpina7serpin family A member 7X110226565110232202Rat
7703593LOC102551064glutamic acid-rich protein-likeX110342419110344016Rat
1565148Pwwp3bPWWP domain containing 3BX110375434110411221Rat
11355376LOC108349242uncharacterized LOC108349242X110455815110474298Rat
9463875LOC103690886uncharacterized LOC103690886X110477183110487576Rat
9114948LOC103690885uncharacterized LOC103690885X110477327110482741Rat
1589457Trap1atumor rejection antigen P1AX110511877110517105Rat
1598251LOC367920similar to 14-3-3 protein zeta/delta (Protein kinase C inhibitor protein 1) (KCIP-1) (Mitochondrial import stimulation factor S1 subunit)X110569803110570618Rat
6499462LOC100910221methionine aminopeptidase 2-likeX110574879110578402Rat
1589413RadxRPA1 related single stranded DNA binding protein, X-linkedX110670037110782420Rat
1566282Rnf128ring finger protein 128X110789061110877964Rat
1563084Tbc1d8bTBC1 domain family member 8BX110894831110983269Rat
6499494LOC100910230protein kinase C and casein kinase substrate in neurons protein 2-likeX111063990111065432Rat
1588264Ripply1ripply transcriptional repressor 1X111099420111114835Rat
1560247Cldn2claudin 2X111122552111133188Rat
1559905Morc4MORC family CW-type zinc finger 4X111143537111191993Rat
1590579Rbm41RNA binding motif protein 41X111272347111325203Rat
1564353Nup62clnucleoporin 62 C-terminal likeX111333274111390023Rat
1566312Dnaaf6dynein axonemal assembly factor 6X111389557111439399Rat
1563753Frmpd3FERM and PDZ domain containing 3X111689587111778943Rat
61955Prps1phosphoribosyl pyrophosphate synthetase 1X111798233111820270Rat
621654Tsc22d3TSC22 domain family, member 3X111884285111944693Rat
1598249LOC367923similar to 60S ribosomal protein L23aX111985603111986110Rat
1565674Mid2midline 2X112019897112121980Rat
9406132LOC103694504uncharacterized LOC103694504X112126558112199204Rat
1587018Tex13btestis expressed 13BX112156631112160456Rat
11400170LOC108353299uncharacterized LOC108353299X112224496112234237Rat
1565570Vsig1V-set and immunoglobulin domain containing 1X112268786112303849Rat
620350Psmd10proteasome 26S subunit, non-ATPase 10X112323188112328642Rat
1596915Atg4aautophagy related 4A, cysteine peptidaseX112328907112403157Rat
1589724Col4a6collagen type IV alpha 6 chainX112405647112768337Rat
9343299LOC10369088860S ribosomal protein L10a-likeX112555128112555864Rat
9373731LOC103694505uncharacterized LOC103694505X112584415112768330Rat
1565499Col4a5collagen type IV alpha 5 chainX112769595112983720Rat
11404186LOC108349243uncharacterized LOC108349243X112770081112778449Rat
1562442Irs4insulin receptor substrate 4X113003824113018088Rat
1583851LOC300277similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)X113121611113122746Rat
1566136RGD1566136similar to 40S ribosomal protein S9X113227678113228313Rat
11387237LOC10834918860S ribosomal protein L24-likeX113248610113249180Rat
1595365LOC681466similar to prohibitinX113250751113251886Rat
620439Gucy2fguanylate cyclase 2FX113372240113474210Rat
1560204Nxt2nuclear transport factor 2-like export factor 2X113509841113517112Rat
1583501Kcne5potassium voltage-gated channel subfamily E regulatory subunit 5X113583844113584459Rat
69401Acsl4acyl-CoA synthetase long-chain family member 4X113596247113660024Rat
9146728LOC10369088960S ribosomal protein L39 pseudogeneX113699593113699764Rat
7634149LOC102554188uncharacterized LOC102554188X113781104113783718Rat
1563286Tmem164transmembrane protein 164X113947355114110064Rat
2325439Mir652microRNA 652X114002534114002614Rat
7658474LOC102550129nuclear receptor subfamily 5 group A member 2-likeX114018421114019455Rat
7575699LOC102554252POU domain, class 5, transcription factor 1-likeX114045564114049709Rat
1561004Ammecr1AMMECR nuclear protein 1X114129829114233013Rat
6486824Rtl9retrotransposon Gag like 9X114367028114379646Rat
1584679LOC681065hypothetical protein LOC681065X114404662114405274Rat
2321164LOC100364395hypothetical LOC100364395X114532606114533357Rat
735215Chrdl1chordin-like 1X114554359114658975Rat
3251Pak3p21 (RAC1) activated kinase 3X114784452115042683Rat
70960Capn6calpain 6X115049113115073824Rat
620670DcxdoublecortinX115098675115175515Rat
1566355RGD1566355similar to cell division cycle 2-like 1X115268134115270936Rat
11468204LOC108349189high mobility group protein B1 pseudogeneX115351012115351755Rat
1560105RGD1560105similar to 40S ribosomal protein S19X115374992115375474Rat
7673510Sertm2serine rich and transmembrane domain containing 2X115400750115412773Rat
1564866RGD1564866similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein)X115424925115426005Rat
1585885LOC680904similar to 60S acidic ribosomal protein P0 (L10E)X115482782115484744Rat
2319323LOC100361854ribosomal protein S26-likeX115495660115496062Rat
1359416Alg13ALG13, UDP-N-acetylglucosaminyltransferase subunitX115561329115589792Rat
11453602LOC108349244putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13X115582591115619339Rat
619787Trpc5transient receptor potential cation channel, subfamily C, member 5X115624670115908248Rat
6503255Trpc5osTRPC5 opposite strandX115702979115725017Rat
11468725LOC108349245ribosome biogenesis protein NSA2 homolog pseudogeneX115795113115796289Rat
1588188Rtl4retrotransposon Gag like 4X115908999116402406Rat
9411186LOC103690890uncharacterized LOC103690890X115909119115924304Rat
1588178LOC680788hypothetical protein LOC680788X116359647116360537Rat
1563295RGD1563295similar to RIKEN cDNA 2310036O22X116557457116558148Rat
727927Lhfpl1LHFPL tetraspan subfamily member 1X116578521116638648Rat
1564027AmotangiomotinX116751231116810238Rat
1588241LOC680725similar to prohibitinX117174086117174851Rat
1333479Olr1758-psolfactory receptor pseudogene 1758X117256398117256859Rat
1334066Olr1754-psolfactory receptor pseudogene 1754X117361863117362148Rat
1333523Olr1762-psolfactory receptor pseudogene 1762X117549808117550166Rat
1584897LOC367757similar to eukaryotic translation initiation factor 4BX117737810117739757Rat
1586013LOC501532similar to Actin, cytoplasmic 2 (Gamma-actin)X117762230117763326Rat

Nucleotide Sequences
GenBank Nucleotide CH474047 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X144092703Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X428214049282140Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X595407850954078Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X15688119127888215Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1815335263153352Rat
1598873Memor2Memory QTL 22.5exploratory behavior trait (VT:0010471)average horizontal distance in proximity to the target during voluntary locomotion in an experimental apparatus (CMO:0002674)X2159262344320739Rat
2290375Gluco34Glucose level QTL 342.75blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X2159262344468300Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X44320616158345622Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX44557974120045269Rat
70221Bp56Blood pressure QTL 564.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X6139809770352120Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X70352120127888215Rat
724551Glom1Glomerulus QTL 12.80.0004kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)X82930791127930791Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X101333032146333032Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX107886746152409805Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X110957467155957467Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X110957467155957467Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 25187 UniSTS
  326439 UniSTS
UniSTS 119217 UniSTS