D3Rat190 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D3Rat190

Symbol: D3Rat190
Also known as: R0005-D06; D14Rat145; oxsts9563; 
RGD ID: 34927
Expected Size: 175 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0332,099,003 - 32,099,181NCBIRnor6.0
Rnor_5.0337,264,372 - 37,264,550UniSTSRnor5.0
RGSC_v3.4328,731,480 - 28,731,658UniSTSRGSC3.4
RGSC_v3.1328,627,851 - 28,628,029RGD
Celera330,637,538 - 30,637,720UniSTS
RH 3.4 Map3367.5RGD
RH 3.4 Map3367.5UniSTS
FHH x ACI Map1415.9999UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CTGTCTCTCCTGTGGGGTGT
Reverse Primer TGCACACCATTTGAATTTCC
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3132972944Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3137891710Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3139773425Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3195176874Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3263142133477544Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3263142148562146Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)3600074834394365Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)3600074851687917Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)3600074851687917Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)3600086634394121Rat
1558657Cm43Cardiac mass QTL 436.60.0000000293heart mass (VT:0007028)heart wet weight (CMO:0000069)3600086634394121Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31009408193415837Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31011931879772001Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)310639528127023997Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)heart rate (CMO:0000002)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691436600143Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)31312691441510346Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31409041148562146Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31409041148562146Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31409041148562146Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31409041148562146Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31409041148562146Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31409041148562146Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31409041148562146Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31802366463023664Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32122380366223803Rat
631685Bp118Blood pressure QTL 1183.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)32465522569655225Rat
1298073Cm13Cardiac mass QTL 132.5heart mass (VT:0007028)heart wet weight (CMO:0000069)32563336639248391Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32813672845772990Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32813672851687917Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32813672851687917Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)32813672851687917Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32813672851687917Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32932171474321714Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32968273274682732Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32968273274682732Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32968273274682732Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32968273274682732Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32968273274682732Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32990825574908255Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32990825574908255Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)330114912123700444Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)330846101172879276Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33110358972989078Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33110358972989078Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33110358972989078Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33110358972989078Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33110358972989078Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33110358972989078Rat


Additional Information

Database Acc Id Source(s)
UniSTS 226645 UniSTS