D4Mgh27 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mgh27

Symbol: D4Mgh27
Previously known as: R5870; oxsts9099; 
RGD ID: 34493
Expected Size: 250 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.04191,499,221 - 191,499,474NCBIRnor5.0
RGSC_v3.44129,308,765 - 129,309,017RGDRGSC3.4
RGSC_v3.14129,553,606 - 129,553,858RGD
RH 3.4 Map4770.5UniSTS
RH 3.4 Map4770.5RGD
RH 2.0 Map4858.9RGD
Cytogenetic Map4 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MR/Pit   ODU/N   WF/Pit   SR/Jr   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   LN/Mav   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Anxrr39   Anxrr29   Anxrr58   Anxrr54   Anxrr56  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TCCTTCACATACATGTGCATACC
Reverse Primer TGAGAAGGGCTGTCAGTGG
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100873066 UniSTS
  100873077 UniSTS
UniSTS 121922 UniSTS