D12Mgh1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D12Mgh1

Symbol: D12Mgh1
Also known as: R1102-C06; oxsts5490; 
RGD ID: 34439
Expected Size: 143 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01215,941,661 - 15,941,791NCBIRnor5.0
RGSC_v3.41212,240,754 - 12,240,883RGDRGSC3.4
RH 3.4 Map12154.6RGD
RH 3.4 Map12154.6UniSTS
RH 2.0 Map12122.0RGD
SHRSP x BN Map1215.9899RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Gluco17   Gluco3   Cm56  


Annotation



Strains and Sequence

Sequence
 
Forward Primer ACACATGCAACCACGCAC
Reverse Primer CCCCAGTTCTGGTGACAATT
 

Region

Nucleotide Sequences


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303205 UniSTS
  326357 UniSTS
  544606 UniSTS
UniSTS 119433 UniSTS