D4Mgh11 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mgh11

Symbol: D4Mgh11
Also known as: R5295; R1100-D09; oxsts5028; 
RGD ID: 34338
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24167,139,447 - 167,139,601 (+)MAPPER
Rnor_6.04168,046,938 - 168,047,091NCBIRnor6.0
Rnor_5.04230,565,073 - 230,565,226UniSTSRnor5.0
RGSC_v3.44171,204,377 - 171,204,531RGDRGSC3.4
RGSC_v3.44171,204,378 - 171,204,531UniSTSRGSC3.4
RGSC_v3.14171,449,313 - 171,449,467RGD
Celera4155,742,437 - 155,742,588UniSTS
RH 3.4 Map41015.5UniSTS
RH 3.4 Map41015.5RGD
RH 2.0 Map41078.1RGD
SHRSP x BN Map487.2499RGD
FHH x ACI Map4107.8999RGD
Cytogenetic Map4 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   DA.E3-(D4Mit16-D4Mgh11)/Rhd   DA.PVG-(D4Rat141-D4Mgh11)   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   SHR.LEW-(D4Rat76-D4Mgh11)  
QTLs:   Cia13   Ciaa4   Hcar9   Pia23   Pia7   Anxrr16   Gluco11   Anxrr34   Anxrr42   Anxrr43   Anxrr32   Anxrr33   Anxrr57  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CTCAACGAACAGGTTTCATTATG
Reverse Primer AGAAGGGATGACAATTGGTACG
 

Region

Nucleotide Sequences
GenBank Nucleotide JH614853 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61451Ciaa4CIA Autoantibody QTL 43.1blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)4125884464168047091Rat
724558Plsm2Polydactyly-luxate syndrome (PLS) morphotypes QTL 20.0003hindlimb integrity trait (VT:0010563)hind foot phalanges count (CMO:0001949)4131834282176834282Rat
1331738Bp209Blood pressure QTL 2092.979arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4136351734180689124Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4108876717169215811Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4105971071168047091Rat
631683Bp116Blood pressure QTL 1160.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4123111827168111827Rat
737978Pia23Pristane induced arthritis QTL 235.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131532269168047091Rat
1582237Kidm34Kidney mass QTL 3440.0001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)4146942075168998263Rat
1298524Oia8Oil induced arthritis QTL 8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4136351734174694858Rat
631511Pia7Pristane induced arthritis QTL 74.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4131532269168047091Rat
2293659Bmd35Bone mineral density QTL 354.50.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)4136908430182878540Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)494893247168046938Rat
634342Cia24Collagen induced arthritis QTL 244.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4145373934176509907Rat
634347Hcar8Hepatocarcinoma resistance QTL 85.8liver integrity trait (VT:0010547)liver tumorous lesion area to total liver area ratio (CMO:0001075)4123478354168478354Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)484475257178931073Rat
1578674Bmd12Bone mineral density QTL 123.8femur mineral mass (VT:0010011)cortical volumetric bone mineral density (CMO:0001730)4137171018182171018Rat
1300109Rf13Renal function QTL 133.91renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)4157423126184226339Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
1358364Sradr4Stress Responsive Adrenal Weight QTL 44.92adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)4128602727173602727Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)486438317168047091Rat
2303623Vencon2Ventilatory control QTL 23.8respiration trait (VT:0001943)minute ventilation (VE) (CMO:0000132)4134917642179917642Rat
1549827Scl46Serum cholesterol level QTL 463.5blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)4131864442176864442Rat
61362Oia2Oil induced arthritis QTL 20.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4136351734174694858Rat
61422Cia13Collagen induced arthritis QTL 134.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4132455408168047091Rat
6478718Anxrr34Anxiety related response QTL 340.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
6478720Alc23Alcohol consumption QTL 230.00509drinking behavior trait (VT:0001422)ethanol drink intake rate to body weight ratio (CMO:0001616)4155386197184226339Rat
6478728Anxrr36Anxiety related response QTL 360.01061locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478733Anxrr37Anxiety related response QTL 370.00095locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478737Anxrr38Anxiety related response QTL 380.00159locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478748Anxrr42Anxiety related response QTL 420.28008locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
6478754Anxrr43Anxiety related response QTL 430.14035locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4145547014184226339Rat
6478757Anxrr44Anxiety related response QTL 440.01087locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478778Anxrr51Anxiety related response QTL 510.25384locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4123587009168587009Rat
6478782Anxrr52Anxiety related response QTL 520.02091locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478785Anxrr53Anxiety related response QTL 530.01397locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4155386197184226339Rat
6478693Anxrr32Anxiety related response QTL 320.00092locomotor behavior trait (VT:0001392)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)4145547014184226339Rat
6478700Anxrr33Anxiety related response QTL 330.00896locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4145547014184226339Rat
7411558Bw133Body weight QTL 13313.840.001body mass (VT:0001259)body weight gain (CMO:0000420)4124442168169442168Rat
10053718Scort25Serum corticosterone level QTL 252.150.0097blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4156855449184226339Rat
10401796Kidm48Kidney mass QTL 48kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)4146497452184226339Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)423850384169318094Rat
12798525Anxrr57Anxiety related response QTL 573.210.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4146086918168047091Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100873069 UniSTS
  100873070 UniSTS
  100873071 UniSTS
  100873080 UniSTS
  100873081 UniSTS
  326430 UniSTS
  326453 UniSTS
  369080 UniSTS
  387410 UniSTS
  408093 UniSTS
  408178 UniSTS
  554297 UniSTS
UniSTS 121915 UniSTS