D10Mgh5 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Mgh5

Symbol: D10Mgh5
Previously known as: oxsts5418; R5123; 
RGD ID: 34274
Expected Size: 223 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81083,061,236 - 83,061,459 (+)Marker Load Pipeline
mRatBN7.21082,564,856 - 82,565,079 (+)MAPPERmRatBN7.2
Rnor_6.01085,513,822 - 85,514,044NCBIRnor6.0
Rnor_5.01085,302,342 - 85,302,564UniSTSRnor5.0
RGSC_v3.41086,316,831 - 86,317,054RGDRGSC3.4
RGSC_v3.41086,316,832 - 86,317,054UniSTSRGSC3.4
Celera1081,321,296 - 81,321,518UniSTS
RGSC_v3.11086,331,202 - 86,331,424RGD
RH 3.4 Map10793.19UniSTS
RH 3.4 Map10793.19RGD
RH 2.0 Map10954.1RGD
Cytogenetic Map10q31UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   LN/Mav   GH/Omr   NEDH/K   COP/OlaHsd   SS/Jr   BN/SsNHsd   LH/Mav   WF/Pit   OM/Ztm   BN-Lx/Cub  
QTLs:   Niddm3   Cari1   Eau9   Aia20   Aia7   Bss91  
Genes:   Srcin1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic analysis of non-insulin dependent diabetes mellitus in the GK rat Galli J, etal., Nat Genet 1996 Jan;12(1):31-7
3. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
4. UniSTS Pipeline RGD automated pipelines
5. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
7. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AAAACACCTTTAGATCAGGAGGG
Reverse Primer TTATTTCCCATCTAGCCTTAAACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
708439Srcin1SRC kinase signaling inhibitor 1108299929583066359Rat

Nucleotide Sequences
GenBank Nucleotide U77632 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105107189796071897Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102702353598502431Rat
8657410Bp374Blood pressure QTL 374heart left ventricle size trait (VT:0002753)heart left ventricle end-diastolic diameter (CMO:0000982)1067476608107713808Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103550938391417879Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063719161107713808Rat
631555Bp134Blood pressure QTL 1340.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)108101207791729860Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042546145107713808Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1058073360103073360Rat
12903252Cm113Cardiac mass QTL 1130.047heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)1066817119107713808Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)105429633699451733Rat
4889948Bss91Bone structure and strength QTL 914tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)108306123692869129Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104183127886831278Rat
1579919Bp281Blood pressure QTL 2810.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105046480295464802Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1064939013107713808Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076951790107713808Rat
1300107Rf18Renal function QTL 183.41urine output (VT:0003620)timed urine volume (CMO:0000260)1079272424102982300Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104493935989939359Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104552916496099749Rat
70168Eae12Experimental allergic encephalomyelitis QTL 120.0009nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1073599825107713808Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1054296227107713808Rat
10450495Bp383Blood pressure QTL 3830.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107674313395464802Rat
12903269Am15Aortic mass QTL 150.042aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1066817119107713808Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105086028895860288Rat
12903266Cm114Cardiac mass QTL 1140.02heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1066817119107713808Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
2292617Ept18Estrogen-induced pituitary tumorigenesis QTL 183.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107395035396620293Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101499153586964295Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062556066107556066Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14282327487823274Rat
724516Uae17Urinary albumin excretion QTL 173.6urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)107870758585720738Rat
12880372Am12Aortic mass QTL 120.003aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1066817119107713808Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072724423107713808Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062556066107556066Rat
12880375Kidm66Kidney mass QTL 660.009kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1066817119107713808Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104493935989939359Rat
1357344Bp249Blood pressure QTL 2490.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106724133498502431Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014991535107556066Rat
12880370Cm105Cardiac mass QTL 1050.008heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)1066817119107713808Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104282327487823274Rat
12880371Cm106Cardiac mass QTL 1060.007heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)1066817119107713808Rat
2306970Anxrr22Anxiety related response QTL 225.95fear/anxiety-related behavior trait (VT:1000241)number of periods of voluntary immobility (CMO:0001045)106184349698710773Rat
11565453Kidm58Kidney mass QTL 580.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1066817119107713808Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)107369533997272278Rat
6893357Bw102Body weight QTL 1020.50.36body mass (VT:0001259)body weight (CMO:0000012)1081012077101828297Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102293137391127454Rat
2306793Ean5Experimental allergic neuritis QTL 54.7nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)107304965694495280Rat
2306792Ean4Experimental allergic neuritis QTL 44nervous system integrity trait (VT:0010566)IFNG-secreting splenocyte count (CMO:0002122)104949549294495492Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1052269185107713808Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)107369533983061459Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)107369533983061459Rat
2298481Eau9Experimental allergic uveoretinitis QTL 90.0169uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)106413959783061459Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068920187107713808Rat
1358915Stresp7Stress response QTL 73.52blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)1065307813107713808Rat
70363Bp71Blood pressure QTL 710.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1061843496106843496Rat
61402Niddm3Non-insulin dependent diabetes mellitus QTL 34.58blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)106184363383061236Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)102980091091417879Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070698731107713808Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)102758722696099902Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)105530797293608131Rat
1558643Cm44Cardiac mass QTL 444.80.0000368heart mass (VT:0007028)heart wet weight (CMO:0000069)1061843496100198886Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104360879388608793Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023948641107713808Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040535708107713808Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040535708107713808Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014991535107713808Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104994371094943710Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040535708107713808Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104493935989939359Rat
1581559Eae18Experimental allergic encephalomyelitis QTL 180.00002nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1066108888107555881Rat
2325836Bp346Blood pressure QTL 3460.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107674313384503487Rat
6893336Cm75Cardiac mass QTL 750.10.87heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1061843496100198886Rat
12880053Cm104Cardiac mass QTL 1040.009heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)107395020983959619Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104786912992869129Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10686461896620484Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)107674313395604677Rat
12880050Am10Aortic mass QTL 100.016aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)103950348784503487Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105060467795604677Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103550938388177745Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072724423107713808Rat
1358188Ept9Estrogen-induced pituitary tumorigenesis QTL 93.9pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)107395035396620293Rat
631537Oia4Oil induced arthritis QTL 4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1076128947107713808Rat
634354Rends3Renal damage susceptibility QTL 30.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)1061997479106997479Rat
2301405Cm69Cardiac mass QTL 690.031heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)1066817119107713808Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102702353599451848Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303181 UniSTS
  100303284 UniSTS
  100381228 UniSTS
  100381229 UniSTS
  100528050 UniSTS
  326411 UniSTS
  326497 UniSTS
  56029 UniSTS