D12Mit8 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D12Mit8

Symbol: D12Mit8
Also known as: oxsts8850; 
RGD ID: 34025
Expected Size: 129 (bp)
Position No map positions available.
Is Marker For: QTLs:   Gluco17   Gluco3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer ACTGTGTGAAGGAGACAGGTAGG
Reverse Primer AGCTTGAGTGCTGATATCAAAGC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 326357 UniSTS
  544606 UniSTS
UniSTS 120812 UniSTS