D1Mit2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit2

Symbol: D1Mit2
Also known as: R1100-A08; R1301; oxsts4766; 
RGD ID: 34011
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.41134,980,527 - 134,980,682UniSTSRGSC3.4
RGSC_v3.41134,980,526 - 134,980,682RGDRGSC3.4
RGSC_v3.11135,058,870 - 135,059,025RGD
Celera1125,236,740 - 125,236,887UniSTS
RH 3.4 Map11060.8RGD
RH 2.0 Map1699.8RGD
SHRSP x BN Map167.76RGD
FHH x ACI Map166.7RGD
Cytogenetic Map1 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   WKY.SHR-(D1Wox19-D1Mit2)/Njs   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp29   Rf2   Mcs3   Cm23   Bp117   Bp160   Bp97   Pia11   Bp84   Bp89   Bp138   Bp200   Scl25  
Genes:   Rf2  


Annotation



Strains and Sequence

Sequence
 
Forward Primer ACTCAAATTCAGCTCAAATCTGC
Reverse Primer TACAACAACATTCACCCCACC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 117527 UniSTS
  246062 UniSTS
  326385 UniSTS
  369030 UniSTS
  369065 UniSTS
  369088 UniSTS
  369113 UniSTS
  369118 UniSTS
  369181 UniSTS
  387421 UniSTS
  408177 UniSTS
  544455 UniSTS
  544462 UniSTS
UniSTS 118505 UniSTS
  260775 UniSTS