D1Mit2 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D1Mit2

Symbol: D1Mit2
Previously known as: R1100-A08; R1301; oxsts4766; 
RGD ID: 34011
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.41134,980,527 - 134,980,682UniSTSRGSC3.4
RGSC_v3.41134,980,526 - 134,980,682RGDRGSC3.4
RGSC_v3.11135,058,870 - 135,059,025RGD
Celera1125,236,740 - 125,236,887UniSTS
RH 3.4 Map11060.8RGD
RH 2.0 Map1699.8RGD
SHRSP x BN Map167.76RGD
FHH x ACI Map166.7RGD
Cytogenetic Map1 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   WKY.SHR-(D1Wox19-D1Mit2)/Njs   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp29   Rf2   Mcs3   Cm23   Bp117   Bp160   Bp97   Pia11   Bp84   Bp89   Bp138   Bp200   Scl25  
Genes:   Rf2  


Annotation


References - curated
# Reference Title Reference Citation
1. A linkage map of the rat genome derived from three F2 crosses. Bihoreau MT, etal., Genome Res 1997 May;7(5):434-40.
2. Renal disease susceptibility and hypertension are under independent genetic control in the fawn-hooded rat. Brown DM, etal., Nat Genet 1996 Jan;12(1):44-51
3. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
4. Successful isolation of a rat chromosome 1 blood pressure quantitative trait locus in reciprocal congenic strains Frantz SA, etal., Hypertension 1998 Oct;32(4):639-46
5. A genetic linkage map of the laboratory rat, Rattus norvegicus. Jacob HJ, etal., Nat Genet 1995 Jan;9(1):63-9
6. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
7. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
8. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
9. UniSTS Pipeline RGD automated pipelines
10. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
11. Genetic identification of multiple loci that control breast cancer susceptibility in the rat Shepel LA, etal., Genetics 1998 May;149(1):289-99
12. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
13. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer ACTCAAATTCAGCTCAAATCTGC
Reverse Primer TACAACAACATTCACCCCACC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 117527 UniSTS
  246062 UniSTS
  326385 UniSTS
  369030 UniSTS
  369065 UniSTS
  369088 UniSTS
  369113 UniSTS
  369118 UniSTS
  369181 UniSTS
  387421 UniSTS
  408177 UniSTS
  544455 UniSTS
  544462 UniSTS
UniSTS 118505 UniSTS
  260775 UniSTS