D19Mit4 Marker Search Result - Rat Genome Database

General

Marker: D19Mit4

Symbol:

D19Mit4

Previously known as:

R975; MIT975; oxsts5741;

RGD ID:

33917

Expected Size:

257 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	19	15,605,023 - 15,605,265 (+)	MAPPER	mRatBN7.2
Rnor_6.0	19	17,028,003 - 17,028,244	NCBI	Rnor6.0
Rnor_5.0	19	28,094,796 - 28,095,037	UniSTS	Rnor5.0
RGSC_v3.4	19	16,770,857 - 16,771,099	RGD	RGSC3.4
RGSC_v3.4	19	16,770,858 - 16,771,099	UniSTS	RGSC3.4
RGSC_v3.1	19	16,775,647 - 16,775,997	RGD
Celera	19	15,511,806 - 15,512,046	UniSTS
RH 2.0 Map	19	284.5	RGD
Cytogenetic Map	19	p11	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub BUF/Pit DA/PitN DON/Melb F344/Pit FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd SHRSP/Riv WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr NEDH/K SS/Jr COP/OlaHsd
QTLs: Rf45
Genes: Fto

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	UniSTS Pipeline	RGD automated pipelines
3.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
5.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CACAAAGCAATCCTGCTTGA
Reverse Primer	TCATTACAGCTAATTAAACACTCCC

Strain Variation

Strain, Expected Size(s)

ACI/N	240
AVN/Orl	240
BBDP/Rhw	240
BBDR/Rhw	240
BC/CpbU	260
BDIX/Han	240
BDVII/Cub	240
BN-Lx/Cub	236
BN/SsNHsd	236
BP/Cub	260
BUF/Pit	240
COP/OlaHsd	240
DA/PitN	240

DON/Melb	240
F344/Pit	240
FHH/Eur	256
GH/Omr	260
GK/KyoSwe	240
IS/Kyo	260
LE/Mol	256
LEW/Pit	240
LH/Mav	240
LN/Mav	240
LOU/CHan	260
M520/N	260
MHS/Gib	240

MNR/N	240
MNRA/N	240
MNS/Gib	240
MR/Pit	240
NEDH/K	260
NP9	240
ODU/N	256
OKA/Wsl	240
OM/Ztm	264
P5C	240
PVG/Pit	260
SD/Rij	240
SHR/OlaHsd	240

SHRSP/Riv	240
SR/Jr	240
SS/Jr	240
WAG/RijKyo	240
WF/Pit	240
WIST/Nhg	240
WKY/OlaHsd	240
WN/N	240
WTC/Kyo	240

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1305121	Fto	FTO, alpha-ketoglutarate dependent dioxygenase	19	15284898	15692142	Rat

Nucleotide Sequences


GenBank Nucleotide	CH474037	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000249	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
7411590	Foco7	Food consumption QTL 7	6.8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	19	1	24688055	Rat
10054132	Srcrt9	Stress Responsive Cort QTL 9	2.87	0.0017	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	19	1	27355345	Rat
631678	Cm9	Cardiac mass QTL 9	4.27	0.0001	aorta mass (VT:0002845)	aorta weight (CMO:0000076)	19	1	28982497	Rat
631681	Cm12	Cardiac mass QTL 12	3.33	0.00053	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	19	1	28982497	Rat
1549847	Bss8	Bone structure and strength QTL 8	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	19	1	31963836	Rat
9590298	Uminl5	Urine mineral level QTL 5	3.59	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	19	1	36824771	Rat
8552935	Pigfal10	Plasma insulin-like growth factor 1 level QTL 10	5.7		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	19	1	36824771	Rat
9590250	Scort11	Serum corticosterone level QTL 11	23.45	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	19	1	36824771	Rat
9590090	Insglur8	Insulin/glucose ratio QTL 8	10.81	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	19	1	36824771	Rat
9589102	Slep13	Serum leptin concentration QTL 13	4.63	0.001	blood leptin amount (VT:0005667)	plasma leptin level (CMO:0000781)	19	569374	45569374	Rat
8694186	Bw152	Body weight QTL 152	3.34	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	19	569374	45569374	Rat
7247442	Uae39	Urinary albumin excretion QTL 39			urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	19	2187927	46708701	Rat
724566	Uae12	Urinary albumin excretion QTL 12	5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	19	2187927	56457239	Rat
61447	Tcas1	Tongue tumor susceptibility QTL 1	6.08		tongue integrity trait (VT:0010553)	squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)	19	2316121	47316121	Rat
2317848	Alcrsp21	Alcohol response QTL 21	1.899999976158142	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	19	3204777	48204777	Rat
1331737	Uae29	Urinary albumin excretion QTL 29	5.5		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	19	4096155	55283277	Rat
724518	Uae19	Urinary albumin excretion QTL 19	5.5		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	19	7457249	42983518	Rat
724565	Tcas5	Tongue tumor susceptibility QTL 5	10.04		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	19	9977753	39654489	Rat
631840	Niddm38	Non-insulin dependent diabetes mellitus QTL 38	3.86		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	19	10323180	23069265	Rat
61423	Cia14	Collagen induced arthritis QTL 14	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	19	10827970	43544039	Rat
61407	Scl12	Serum cholesterol level QTL 12		0.001	blood HDL cholesterol amount (VT:0000184)	serum high density lipoprotein cholesterol level (CMO:0000361)	19	13926401	30303727	Rat
1558656	Prcs1	Prostate cancer susceptibility QTL 1	5		prostate integrity trait (VT:0010571)	percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)	19	15114598	34521833	Rat
7411549	Bw130	Body weight QTL 130	5	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	19	15455860	57337602	Rat
1331788	Rf45	Renal function QTL 45	2.818		kidney blood vessel physiology trait (VT:0100012)	absolute change in renal blood flow rate (CMO:0001168)	19	15605023	46559041	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	291905	UniSTS
	544450	UniSTS
UniSTS	119347	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D19Mit4