D2Mit29 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Mit29

Symbol: D2Mit29
Previously known as: R696; oxsts9053; 
RGD ID: 33822
Expected Size: 246 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.227,887,772 - 7,888,014 (+)MAPPERmRatBN7.2
Rnor_6.025,417,336 - 5,417,577NCBIRnor6.0
Rnor_5.025,396,621 - 5,396,862UniSTSRnor5.0
RGSC_v3.425,601,528 - 5,601,770RGDRGSC3.4
RGSC_v3.425,601,529 - 5,601,770UniSTSRGSC3.4
RGSC_v3.125,627,976 - 5,628,373RGD
Celera24,338,310 - 4,338,555UniSTS
Cytogenetic Map2q11UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   WF.COP-(D2Mit29-D2Rat201)/Uwm   M520/N   WF.COP-(D2Mit29-D2Uwm13)/Uwm   ACI/N   BN-Lx/Cub   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Mcs1   Mamtr2   Mcs18  
Genes:   Fam172a  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Genetic identification of Mcs-1, a rat mammary carcinoma suppressor gene. Hsu LC, etal., Cancer Res 1994 May 15;54(10):2765-70
3. UniSTS Pipeline RGD automated pipelines
4. Genetic identification of multiple loci that control breast cancer susceptibility in the rat Shepel LA, etal., Genetics 1998 May;149(1):289-99
5. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer CTTTCAGACGTGCAAGAGACC
Reverse Primer GCTTTTCTGACATGATTGATGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305526Fam172afamily with sequence similarity 172, member A275538738018183Rat

Nucleotide Sequences
GenBank Nucleotide AC122587 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
731166Mamtr2Mammary tumor resistance QTL 20.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777212654247Rat
61368Mcs1Mammary carcinoma susceptibility QTL 14.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777223319447Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302898 UniSTS
  294606 UniSTS
  326383 UniSTS
  408086 UniSTS
UniSTS 120391 UniSTS