D4Mit14 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Mit14

Symbol: D4Mit14
Also known as: R526; MIT526; oxsts5044; 
RGD ID: 33768
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.04226,467,963 - 226,468,114NCBIRnor5.0
Rnor_5.04230,803,731 - 230,803,873NCBIRnor5.0
Rnor_5.04226,319,261 - 226,319,403NCBIRnor5.0
Rnor_5.04226,682,059 - 226,682,213NCBIRnor5.0
RGSC_v3.44165,174,287 - 165,174,437RGDRGSC3.4
RGSC_v3.44164,691,265 - 164,691,406RGDRGSC3.4
RGSC_v3.44164,772,647 - 164,772,800RGDRGSC3.4
RGSC_v3.14165,017,584 - 165,017,736RGD
RH 3.4 Map41013.22RGD
RH 3.4 Map41013.22UniSTS
RH 2.0 Map41059.1RGD
Cytogenetic Map4 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia13   Ciaa4  


Annotation



Strains and Sequence

Sequence
 
Forward Primer AGGACAGGTTTTTGGGCTTT
Reverse Primer TCTGCCGCCACCTTAGAG
 

Region

Nucleotide Sequences
GenBank Nucleotide JH614816 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326430 UniSTS
  326453 UniSTS
UniSTS 119289 UniSTS