D1Mit4 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mit4

Symbol: D1Mit4
Also known as: R214; oxsts4768; 
RGD ID: 33646
Expected Size: 213 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RH 3.4 Map11322.4UniSTS
RH 3.4 Map11322.4RGD
RH 2.0 Map1852.2RGD
Cytogenetic Map1 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   WAG/RijKyo   M520/N   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bp97   Schws2   Edcs4   Foco11   Bw147  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CAGTCAGAACAATGGTGCTCA
Reverse Primer AAAGAAAGATGAAGTGCACGC
 

Region

Nucleotide Sequences


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303029 UniSTS
  100303244 UniSTS
  369065 UniSTS
UniSTS 118506 UniSTS