D4S3186 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D4S3186

Symbol: D4S3186
Also known as: WI-9796; MR12456; GDB:678465; G00-678-465; 
RGD ID: 2179385
Expected Size: 225 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37471,862 - 72,085UniSTSGRCh37
GRCh374190,475,374 - 190,475,598UniSTSGRCh37
Build 364190,712,368 - 190,712,592RGDNCBI36
Celera4187,770,322 - 187,770,546RGD
Cytogenetic Map4q35.2UniSTS
HuRef4186,193,230 - 186,193,454UniSTS
Whitehead-YAC Contig Map4 UniSTS
Is Marker For: Genes:   LINC01667  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCAATTTAAAATTGCGGAA
Reverse Primer AGGACAGGGAGTGAGATAAATAAA
 

Region

Nucleotide Sequences
GenBank Nucleotide AC018687 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC018692 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC208869 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC216969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC243969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244032 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003451 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471056 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000255 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000465 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000494 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000666 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486019 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS488218 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990657 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS994187 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G05421 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000046 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000193 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976326 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KE133938 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 441058 UniSTS
UniSTS D4S3186 UniSTS SSLP Pipeline