STS-R79401 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: STS-R79401

Symbol: STS-R79401
Previously known as:
RGD ID: 2115845
Expected Size: 152 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37818,080,538 - 18,080,688UniSTSGRCh37
Build 36818,124,818 - 18,124,968RGDNCBI36
Celera817,046,469 - 17,046,619RGD
Cytogenetic Map8p22UniSTS
HuRef816,624,861 - 16,625,011UniSTS
GeneMap99-GB4 RH Map864.82UniSTS
Is Marker For: Genes:   NAT1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CACCAATTTCCAAGATAACC
Reverse Primer GACATCAAATCATTTCACCC
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_000662 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160170 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160171 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160172 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160173 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160174 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160175 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160176 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001160179 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC025062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC124242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF032677 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF032678 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF067408 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF071552 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF308866 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ278017 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ307007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ581142 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ581143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AP006208 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY338489 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY376850 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY800271 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC013732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC047666 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX647521 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003455 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003503 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471080 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000469 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000670 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001616.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D90041 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305816 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305818 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305819 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305820 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305821 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305822 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305823 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305824 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305825 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305826 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305827 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305828 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305829 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305830 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305831 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305832 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305834 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305836 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305837 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305838 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305839 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305842 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305843 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305844 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305845 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305846 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305847 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305848 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305849 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305850 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305851 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305852 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305853 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305854 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305856 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305857 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305858 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305859 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305860 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305861 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305862 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305863 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305864 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305865 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305866 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305867 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305868 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305869 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305870 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305871 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305872 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305873 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305874 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305875 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305876 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305877 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305878 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305879 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305880 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305881 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305882 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305883 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305884 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305885 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305886 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305887 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305888 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305889 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305890 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305891 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305892 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305893 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305894 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305895 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305896 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305897 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305899 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305900 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305901 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305902 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305903 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305904 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305905 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305907 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305909 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305910 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305911 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305912 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305913 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305914 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305915 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305916 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305917 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305918 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305919 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305920 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305921 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305922 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305923 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305924 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305925 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305926 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305927 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305928 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305929 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305931 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305932 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305933 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305934 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305935 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305936 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305937 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305938 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305939 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305940 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305941 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305942 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305943 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305944 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305945 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305946 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305958 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305960 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305961 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305962 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305963 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305964 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305968 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305971 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305973 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ305975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486094 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976340.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S78829 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U80835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X17059 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 9 UniSTS
UniSTS STS-R79401 UniSTS SSLP Pipeline