ECD06900 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: ECD06900

Symbol: ECD06900
Previously known as:
RGD ID: 1811792
Expected Size: 697 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X153,760,015 - 153,760,711UniSTSGRCh37
Build 36X153,413,209 - 153,413,905RGDNCBI36
CeleraX153,921,063 - 153,921,759RGD
Cytogenetic MapXq28UniSTS
HuRefX142,336,511 - 142,337,207UniSTS
Is Marker For: Genes:   G6PD  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGGATGGTCTCGAGTGCT
Reverse Primer CAGTGGCATCAGCAAGACAC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC244090.3 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC244107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF277315 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158096 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158097 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158098 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158100 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158101 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158102 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158104 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158105 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158106 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158107 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158109 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158110 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158111 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158113 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158115 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158116 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158117 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158118 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158119 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158122 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158123 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158124 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158125 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158127 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158128 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158130 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158131 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158134 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158135 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158137 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158138 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158140 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158141 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY158142 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003470 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003518 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471172 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000274 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000484 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000513 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001631.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CT009680 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173568 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173592 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173593 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173594 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173595 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173596 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173597 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173598 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173599 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173600 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173601 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173602 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173603 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173604 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173605 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173606 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173607 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173608 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173609 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173610 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173613 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173614 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173615 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173616 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173617 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173618 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173619 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173621 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173622 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173623 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173624 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173625 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173626 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173627 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173628 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173629 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173630 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173631 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173632 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173633 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173634 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173635 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173637 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173638 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173639 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173640 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173641 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ173642 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486342 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000173 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583507.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH159150.2 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976431.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L44140 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X55448 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 2539 UniSTS
UniSTS ECD06900 UniSTS SSLP Pipeline