PMC109173P1 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: PMC109173P1

Symbol: PMC109173P1
Previously known as:
RGD ID: 1791392
Expected Size: 880 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37MT7,483 - 8,364UniSTSGRCh37
GRCh371568,034 - 568,913UniSTSGRCh37
Build 361557,897 - 558,776RGDNCBI36
HuRef14,288 - 5,167UniSTS
Is Marker For: Genes:   PTGS1   MT-ATP8   MT-TS1   MT-TK   MT-CO2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAAGCCAACCCCATGGCCTC
Reverse Primer TCACTGTAAAGAGGTGTTGG
 

Region

Nucleotide Sequences
GenBank Nucleotide AB055387 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC067849 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC114498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC136309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF035429 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF134583 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346963 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346964 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346968 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346971 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346973 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346976 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346977 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346978 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346981 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346982 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346983 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346984 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346985 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346987 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346992 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346993 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346994 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346995 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346996 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346998 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF346999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347000 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347001 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347003 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347004 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347008 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347009 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347010 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347011 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347014 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF347015 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381981 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381982 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381983 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381985 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381987 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381988 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381989 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381992 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381993 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381994 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381995 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381998 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF381999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382000 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382001 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382003 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382004 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382009 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382010 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382011 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF382013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465941 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465942 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465943 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465944 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465945 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465946 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465947 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465952 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465958 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465960 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465961 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465962 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465963 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465964 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465965 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465966 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465968 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465969 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465970 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465971 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465973 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465976 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465977 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465978 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF465980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195748 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195751 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195757 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195761 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195764 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195766 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195771 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195773 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195777 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195780 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY195787 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY255133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY255135 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY255137.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289052 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289053 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289054 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289055 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289056 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289057 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289059 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289060 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289061 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289066 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289068 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289069 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289071 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289072 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289074 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289075 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289076 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289077 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289078 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289080 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289081 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289082 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289083 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289084 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289085 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289086 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289087 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289088 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289089 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289090 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289091 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289092 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289093 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289094 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289095 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289096 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289097 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289098 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289099 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289100 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289101 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY289102 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D38112 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M25171 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V00662 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X62996 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X93334 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 4508 UniSTS
  4509 UniSTS
  4513 UniSTS
  4514 UniSTS
  4566 UniSTS
  4574 UniSTS
UniSTS PMC109173P1 UniSTS SSLP Pipeline