D5S1683E Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D5S1683E

Symbol: D5S1683E
Previously known as: GDB:443139; 
RGD ID: 1735568
Expected Size: 192 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh375140,390,021 - 140,390,212UniSTSGRCh37
Build 365140,370,205 - 140,370,396RGDNCBI36
Celera5136,466,800 - 136,466,991RGD
Cytogenetic Map5q31UniSTS
HuRef5135,534,720 - 135,534,911UniSTS
Is Marker For: Genes:   PCDHA4   PCDHA3   PCDHA2   PCDHAC2   PCDHA8   PCDHA13   PCDHA12   PCDHA6   PCDHA9   PCDHA10   PCDHA1   PCDHAC1   PCDHA5   PCDHACT   PCDHA11   PCDHA@   PCDHA7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTATGATGCAGATTTTAGG
Reverse Primer GACAAATAAACAGCGGAAG
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_018898 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018899 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018900 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018901 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018902 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018903 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018904 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018905 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018906 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018907 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018909 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018910 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_018911 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_031411 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_031849 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_031857 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_031860 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB208924 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB208925 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB209205 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC008688 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC010223 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC025436 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152303 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152304 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152305 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152306 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152307 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152308 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152310 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152311 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152313 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152314 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152315 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152316 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF152317 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK075556 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC033735 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC036674 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC063288 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC130447 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV180174 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003452 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003500 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH889695.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000256 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000466 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000495 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001613.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486067 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990705 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000050 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL301909.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL582980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976330.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 56117 UniSTS
  56119 UniSTS
  56134 UniSTS
  56135 UniSTS
  56136 UniSTS
  56137 UniSTS
  56138 UniSTS
  56139 UniSTS
  56140 UniSTS
  56141 UniSTS
  56142 UniSTS
  56143 UniSTS
  56144 UniSTS
  56145 UniSTS
  56146 UniSTS
  56147 UniSTS
  9752 UniSTS
UniSTS D5S1683E UniSTS SSLP Pipeline