D19S1163 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19S1163

Symbol: D19S1163
Previously known as: D19S430; GATA10A05; SHGC-4165; SHGC-17679; GDB:228747; GDB:1298119; CHLC.799; GATA-P6875; GATA-D19S430; CHLC.GATA10A05; CHLC.GATA10A05.799; CHLC.GATA10A05.P6875; 
RGD ID: 1657125
Expected Size: 130 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371932,302,506 - 32,302,635UniSTSGRCh37
Build 361936,994,346 - 36,994,475RGDNCBI36
Celera1928,996,131 - 28,996,260RGD
HuRef1928,805,811 - 28,805,944UniSTS
Marshfield Genetic Map1956.69UniSTS
TNG Radiation Hybrid Map1911455.0UniSTS
deCODE Assembly Map1954.22UniSTS
Stanford-G3 RH Map191273.0UniSTS
Stanford-G3 RH Map191276.0UniSTS
Whitehead-RH Map19250.0UniSTS
Whitehead-YAC Contig Map19 UniSTS
NCBI RH Map19306.9UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCCCATACATCAATGAGTG
Reverse Primer CTAGCCTGACTGTGCACTCC
 

Region



Additional Information

Database Acc Id Source(s)
UniSTS D19S1163 UniSTS SSLP Pipeline