D2Got420 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D2Got420

Symbol: D2Got420
Previously known as: oxsts3118; OT12.40; D0Got192; 
RGD ID: 1639207
Expected Size: 273 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22245,650,141 - 245,650,414 (+)MAPPERmRatBN7.2
Rnor_6.02262,939,797 - 262,940,069NCBIRnor6.0
Rnor_5.02281,611,213 - 281,611,485UniSTSRnor5.0
RGSC_v3.42254,692,741 - 254,693,013UniSTSRGSC3.4
Celera2237,468,995 - 237,469,267UniSTS
Cytogenetic Map2q45UniSTS
Is Marker For: Genes:   Negr1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCAAGACCTTGAAGCCATCA
Reverse Primer TTTTCATGAAACCCCAAAACATG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
708416Negr1neuronal growth regulator 12245624460246359605Rat

Nucleotide Sequences
GenBank Nucleotide AU028945 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2200990457245990457Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2212828222249053267Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2214226044247136170Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2219753301247136170Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2223389739249053267Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2223389739249053267Rat
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2229059610249053267Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 59318 UniSTS
UniSTS 116005 UniSTS