D5Got200 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D5Got200

Symbol: D5Got200
Also known as: oxsts4216; OT76.07; 
RGD ID: 1635992
Expected Size: 132 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.253,149,972 - 3,150,104 (+)MAPPERmRatBN7.2
Rnor_6.052,562,176 - 2,562,307NCBIRnor6.0
Rnor_5.052,550,434 - 2,550,959UniSTSRnor5.0
Rnor_5.052,550,434 - 2,550,565UniSTSRnor5.0
RGSC_v3.452,248,538 - 2,248,669UniSTSRGSC3.4
Celera52,751,754 - 2,751,885UniSTS
Cytogenetic Map5 RGD


Annotation


References - curated
1. Data downloaded from Wellcome Trust, University of Oxford
2. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCTGGAAAGGATTTTTTGG
Reverse Primer GCAAATGTGGGATATTTTGTTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU025103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU028546 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
2312562Pur18Proteinuria QTL 182.60.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)5213896532656739Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
631551Vetf1Vascular elastic tissue fragility QTL 150.0001aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)522822265904428Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112220 UniSTS