D5Got204 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D5Got204

Symbol: D5Got204
Previously known as: oxsts3765; OT46.23; 
RGD ID: 1635380
Expected Size: 121 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2513,644,165 - 13,644,286 (+)MAPPERmRatBN7.2
Rnor_6.0513,530,567 - 13,530,687NCBIRnor6.0
Rnor_5.0518,304,488 - 18,304,608UniSTSRnor5.0
RGSC_v3.4513,814,660 - 13,814,780UniSTSRGSC3.4
Celera513,032,905 - 13,033,025UniSTS
Cytogenetic Map5q12UniSTS
Is Marker For: Genes:   Psmd12-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAAGTATACATGTTAAATGTGAAG
Reverse Primer AATCTTCCTGGGCTCGTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1586095Psmd12-ps1proteasome 26S subunit, non-ATPase 12, pseudogene 151362624113708195Rat

Nucleotide Sequences
GenBank Nucleotide AU027336 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331756Rf34Renal function QTL 344.16275kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)5190450412Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1331771Rf35Renal function QTL 354.36965kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)572947086724018Rat
2312562Pur18Proteinuria QTL 182.60.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)5213896532656739Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
8662454Vetf3Vascular elastic tissue fragility QTL 327.4artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)5228222669540447Rat
2313085Bss59Bone structure and strength QTL 592.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)5384401826141981Rat
1300117Hrtrt8Heart rate QTL 83.49heart pumping trait (VT:2000009)heart rate (CMO:0000002)5384401847869213Rat
61462Niddm10Non-insulin dependent diabetes mellitus QTL 103.90.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)5511215947171491Rat
631827Alc4Alcohol consumption QTL 43.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)5818750118616199Rat
2293666Bmd38Bone mineral density QTL 384.4femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)5894822853948228Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5982326699753708Rat
1641903Alcrsp3Alcohol response QTL 3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)51268928557689285Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 366301 UniSTS
UniSTS 113407 UniSTS