D9Got226 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D9Got226

Symbol: D9Got226
Also known as: oxsts4172; OT73.17; D0Got876; 
RGD ID: 1634430
Expected Size: 155 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.09108,306,208 - 108,306,362NCBIRnor6.0
Rnor_6.09108,306,208 - 108,306,584NCBIRnor6.0
Rnor_5.09107,887,168 - 107,887,544UniSTSRnor5.0
Rnor_5.09107,887,168 - 107,887,322UniSTSRnor5.0
RGSC_v3.4999,437,836 - 99,437,990UniSTSRGSC3.4
Celera998,005,498 - 98,005,649UniSTS
Cytogenetic Map9 RGD


Annotation


References - curated
1. Data downloaded from Wellcome Trust, University of Oxford
2. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCCAACCCAAGAAACCTAA
Reverse Primer TATTTTGGTCATGATGATAGTGGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028052 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)990024661119983851Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)966757444112943287Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)981411073119983851Rat
1354645Swd1Spike wave discharge measurement QTL 13.910.00012brain electrophysiology trait (VT:0010557)mean duration of a single type I spike-and-wave discharge train (CMO:0002064)9107198926110038814Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)970241351115241351Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)929075079122095297Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)970942881115942881Rat
724547Cm21Cardiac mass QTL 212.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)983686153111609081Rat


Additional Information

Database Acc Id Source(s)
UniSTS 112706 UniSTS