D19S222 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19S222

Symbol: D19S222
Previously known as: AFM234vb2; SHGC-969; 234VB2; HS234VB2; GDB:188459; 
RGD ID: 1341900
Expected Size: 195 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371928,725,945 - 28,726,177UniSTSGRCh37
GRCh371928,725,974 - 28,726,162UniSTSGRCh37
Build 361933,417,814 - 33,418,002RGDNCBI36
Celera1925,428,077 - 25,428,269RGD
Celera1925,428,048 - 25,428,284UniSTS
HuRef1925,241,748 - 25,241,940UniSTS
HuRef1925,241,719 - 25,241,955UniSTS
Marshfield Genetic Map1949.75RGD
Genethon Genetic Map1949.4UniSTS
TNG Radiation Hybrid Map1910056.0UniSTS
Stanford-G3 RH Map191030.0UniSTS
GeneMap99-GB4 RH Map19172.15UniSTS
Whitehead-RH Map19203.0UniSTS
Whitehead-YAC Contig Map19 UniSTS
NCBI RH Map19259.7UniSTS
GeneMap99-G3 RH Map191041.0UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAACTGTGCTCTTAGGAAGTCA
Reverse Primer AGGCCAAAATAATCTTCAGG
 

Region



Additional Information

Database Acc Id Source(s)
UniSTS D19S222 UniSTS SSLP Pipeline