D16S409 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16S409

Symbol: D16S409
Previously known as: AFM161xa1; SHGC-794; 161XA1; HS161XA1; GDB:188117; 
RGD ID: 1338250
Expected Size: 139 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371648,775,871 - 48,776,009UniSTSGRCh37
GRCh371648,775,868 - 48,776,017UniSTSGRCh37
Build 361647,333,369 - 47,333,518RGDNCBI36
Celera1633,288,574 - 33,288,723RGD
Celera1633,288,577 - 33,288,715UniSTS
HuRef1634,666,518 - 34,666,667UniSTS
HuRef1634,666,521 - 34,666,659UniSTS
Marshfield Genetic Map1658.46RGD
Marshfield Genetic Map1658.46UniSTS
Genethon Genetic Map1656.2UniSTS
TNG Radiation Hybrid Map1619101.0UniSTS
deCODE Assembly Map1658.41UniSTS
Stanford-G3 RH Map161676.0UniSTS
GeneMap99-GB4 RH Map16327.21UniSTS
Whitehead-RH Map16254.8UniSTS
Whitehead-YAC Contig Map16 UniSTS
NCBI RH Map16357.6UniSTS
GeneMap99-G3 RH Map162120.0UniSTS
Is Marker For: Genes:   NOD2  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAATCTTACATCCCATCCC
Reverse Primer AGTCAGTCTGTCCAGAGGTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AC007611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC023827 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003463 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003511 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471092 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000267 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000477 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000506 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000678 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001624.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486198 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990836 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL298209.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583013 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976392.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z16713 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 64127 UniSTS
UniSTS 69754 UniSTS