D19S228 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19S228

Symbol: D19S228
Previously known as: AFM238xc7; stSG774; SHGC-979; 238XC7; HS238XC7; GDB:188728; GC378-D19S228; 
RGD ID: 1338234
Expected Size: 154 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371938,489,500 - 38,489,708UniSTSGRCh37
GRCh371938,489,538 - 38,489,695UniSTSGRCh37
GRCh371938,489,647 - 38,489,695UniSTSGRCh37
Build 361943,181,487 - 43,181,535RGDNCBI36
Celera1935,290,897 - 35,290,945RGD
Celera1935,290,754 - 35,290,958UniSTS
Celera1935,290,792 - 35,290,945UniSTS
Cytogenetic Map19q13.13UniSTS
HuRef1934,937,645 - 34,937,798UniSTS
HuRef1934,937,750 - 34,937,798UniSTS
HuRef1934,937,607 - 34,937,811UniSTS
Marshfield Genetic Map1962.25RGD
Genethon Genetic Map1961.4UniSTS
TNG Radiation Hybrid Map1914226.0UniSTS
deCODE Assembly Map1963.58UniSTS
Stanford-G3 RH Map191636.0UniSTS
GeneMap99-GB4 RH Map19221.6UniSTS
Whitehead-RH Map19287.5UniSTS
NCBI RH Map19394.2UniSTS
GeneMap99-G3 RH Map191647.0UniSTS
Is Marker For: Genes:   SIPA1L3  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTTTGGGTACAAGGGAGTTC
Reverse Primer GCTTTTCATGGTCACACAAT
 

Region

Nucleotide Sequences
GenBank Nucleotide AC008395 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC234089 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003466 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003514 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000270 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000509 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000681 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001627.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486085 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000140 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL301624.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583225 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976404.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z17070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 23094 UniSTS
UniSTS 59797 UniSTS