D19S421 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19S421

Symbol: D19S421
Previously known as: AFMa123xe5; A123XE5; stSG1210; SHGC-2313; GDB:200105; HSA123XE5; 
RGD ID: 1337182
Expected Size: 145 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371938,871,266 - 38,871,408UniSTSGRCh37
GRCh371938,871,203 - 38,871,390UniSTSGRCh37
GRCh371938,871,266 - 38,871,339UniSTSGRCh37
Build 361943,563,043 - 43,563,230RGDNCBI36
Celera1935,673,501 - 35,673,574UniSTS
Celera1935,673,438 - 35,673,627RGD
Celera1935,673,501 - 35,673,645UniSTS
Cytogenetic Map19q13.2UniSTS
HuRef1935,318,858 - 35,318,931UniSTS
HuRef1935,318,795 - 35,318,984UniSTS
HuRef1935,318,858 - 35,319,002UniSTS
Marshfield Genetic Map1963.1RGD
Genethon Genetic Map1962.0UniSTS
TNG Radiation Hybrid Map1914500.0UniSTS
deCODE Assembly Map1964.12UniSTS
Stanford-G3 RH Map191614.0UniSTS
GeneMap99-GB4 RH Map19226.94UniSTS
NCBI RH Map19384.2UniSTS
GeneMap99-G3 RH Map191625.0UniSTS
Is Marker For: Genes:   PSMD8  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTACCCCCTCTTCCAGAAAG
Reverse Primer TGAGATAATGAGATGCCAGC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 5714 UniSTS
UniSTS 56277 UniSTS