D8S550 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D8S550

Symbol: D8S550
Previously known as: AFM304ze9; 304ZE9; stSG1115; SHGC-1962; GDB:200255; HS304ZE9; 
RGD ID: 1335747
Expected Size: 103 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37810,881,696 - 10,881,810UniSTSGRCh37
GRCh37810,881,555 - 10,881,823UniSTSGRCh37
Build 36810,918,965 - 10,919,233RGDNCBI36
Celera810,009,549 - 10,009,667UniSTS
Celera810,009,408 - 10,009,680RGD
Cytogenetic Map8p23.1UniSTS
HuRef89,811,515 - 9,811,787UniSTS
HuRef89,811,656 - 9,811,774UniSTS
Marshfield Genetic Map821.33UniSTS
Marshfield Genetic Map821.33RGD
Genethon Genetic Map820.4UniSTS
TNG Radiation Hybrid Map85576.0UniSTS
Stanford-G3 RH Map8464.0UniSTS
GeneMap99-GB4 RH Map837.66UniSTS
Whitehead-YAC Contig Map8 UniSTS
NCBI RH Map8105.8UniSTS
GeneMap99-G3 RH Map8551.0UniSTS
Is Marker For: Genes:   XKR6  


Annotation


References - curated
# Reference Title Reference Citation
1. Comprehensive human genetic maps: individual and sex-specific variation in recombination. Broman KW, etal., Am J Hum Genet 1998 Sep;63(3):861-9.
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGGAGTCAATAACCCAAAGTCAT
Reverse Primer TGGCACATCCCGAAGTC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC105108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF131215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003455 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003503 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471157 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000469 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000498 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000670 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001616.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486168 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990806 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL293847.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976340.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  Z24258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 286046 UniSTS
UniSTS D8S550 UniSTS SSLP Pipeline