4582 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: 4582

Symbol: 4582
Also known as:
RGD ID: 12903262
Type: SNP
Expected Size: 201 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.41346,195,114 - 46,195,314RGDRGSC3.4
Is Marker For: Strains:   SS.BN-(D13Hmgc64-4582)/Mcwi  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TTGATCCTCATGGATGTTGC
Reverse Primer CGCTTCTTTGGATGAAGACC
 

Region

Nucleotide Sequences


Additional Information