D20Arb2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D20Arb2

Symbol: D20Arb2
Also known as: R0270-D07; oxsts7797; 
RGD ID: 11206
Expected Size: 164 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2202,666,495 - 2,666,654 (+)MAPPER
mRatBN7.2202,646,395 - 2,646,556 (+)MAPPER
Rnor_6.0203,151,815 - 3,151,975NCBIRnor6.0
Rnor_6.0203,171,911 - 3,172,069NCBIRnor6.0
Rnor_5.0205,270,077 - 5,270,235UniSTSRnor5.0
Rnor_5.0205,249,981 - 5,250,141UniSTSRnor5.0
RGSC_v3.4202,790,512 - 2,790,672UniSTSRGSC3.4
RGSC_v3.4202,811,408 - 2,811,567RGDRGSC3.4
RGSC_v3.4202,790,511 - 2,790,672RGDRGSC3.4
RGSC_v3.4202,811,409 - 2,811,567UniSTSRGSC3.4
RGSC_v3.1202,790,738 - 2,790,899RGD
Celera2076,870 - 77,030UniSTS
Celera2096,911 - 97,069UniSTS
SHRSP x BN Map200.0RGD
SHRSP x BN Map200.0UniSTS
FHH x ACI Map200.16RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   DA.F344-Aia1/1   F344.DA-(D20Arb2-D20Arb8)/Arb   DA.F344-(D20Arb2-D20Arb8)/Arb   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Ciaa1   Aia1  
Genes:   Ciaa1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CAGGAGGATTAAGAGAGGTGCC
Reverse Primer CTGGCTTCAGAGATTCAACTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3501RT1-O1RT1 class Ib, locus O12031605353162939Rat
1595920RT1-S2RT1 class Ib, locus S22031520733165871Rat
1595735Rps2-ps1ribosomal protein S2, pseudogene 12031594763160204Rat
1598370RT1-N3RT1 class Ib, locus N32031667933170945Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724519Bp144Blood pressure QTL 1440.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2015192000Rat
1354642Despr15Despair related QTL 150.0027locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)20124652101Rat
1600382Edcs3Endometrial carcinoma susceptibility QTL33.50.003uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)20125653396Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20126305996Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20126305996Rat
7387283Uae44Urinary albumin excretion QTL 440.1712urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)20127357423Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20128375393Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20128375393Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20128375393Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20128375393Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20128375393Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20133300419Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20137550487Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20137550487Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20201865447018654Rat
2306850Pia40Pristane induced arthritis QTL 400.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2020187706567419Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20299970747999707Rat
61472Aia1Adjuvant induced arthritis QTL 1180.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)2031518156896013Rat
61448Ciaa1CIA Autoantibody QTL 1300.001blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)2031518156896013Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 326474 UniSTS
  474368 UniSTS
UniSTS 227284 UniSTS