D10Mgh9 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D10Mgh9

Symbol: D10Mgh9
Also known as: R1102-B03; oxsts8806; 
RGD ID: 10794
Expected Size: 124 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01038,968,672 - 38,968,801NCBIRnor6.0
Rnor_5.01038,750,399 - 38,750,528UniSTSRnor5.0
RGSC_v3.41039,079,275 - 39,079,404UniSTSRGSC3.4
RGSC_v3.41039,079,274 - 39,079,404RGDRGSC3.4
RGSC_v3.11039,087,845 - 39,087,975RGD
Celera1037,120,106 - 37,120,235UniSTS
Cytogenetic Map10q22UniSTS
RH 3.4 Map10404.0UniSTS
RH 3.4 Map10404.0RGD
RH 2.0 Map10433.4RGD
SHRSP x BN Map1036.2799RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Apr3  
Genes:   Il4  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCAGCCTTGACACGGTATCT
Reverse Primer TTTTTTTCAGAAATGCATGGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2898Il4interleukin 4103896397938969531Rat

Nucleotide Sequences
GenBank Nucleotide AC107611 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X53087 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142669970Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)10144902893Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1076442166221621Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10587753664401490Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10622909575983805Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10642907599492409Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10752145052521450Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109841807108540162Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101263951357639513Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101263951357639513Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101482789492423564Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014827894107857673Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014827894110992275Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101537547462469074Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101646873661468736Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11712154262121542Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101824639453637634Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101940281464402814Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)1020170031102897474Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102152390683549467Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)12152390690312401Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)12152390690312401Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102152390690312401Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102170776664648311Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102290149793886300Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102386101566539843Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1023861015112626471Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1024483076107857673Rat
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)102488408447487910Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102723753064648311Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)1027237530101482600Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1027237530102427718Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102878928073789280Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)103002135454057745Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103009990975099909Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)103098380575983805Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103191939778343192Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103317903078179030Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103334319278343192Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103513942480139424Rat
61332Eau3Experimental allergic uveoretinitis QTL 30.004uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)103566946546851407Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)103618592982675365Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)103618592995845311Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103658437353645194Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103658437366539843Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103658456066015527Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 287287 UniSTS
  369133 UniSTS
UniSTS 120624 UniSTS