D1Mgh12 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Mgh12

Symbol: D1Mgh12
Also known as: S65119; R1100-B03; CASPAT; oxsts4756; 
RGD ID: 10674
Expected Size: 102 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01270,716,905 - 270,717,037NCBIRnor5.0
RGSC_v3.41247,322,146 - 247,322,277RGDRGSC3.4
RGSC_v3.11247,436,621 - 247,436,752RGD
Celera1238,204,080 - 238,204,181UniSTS
RH 3.4 Map11616.91UniSTS
RH 3.4 Map11616.91RGD
RH 2.0 Map11221.1RGD
SHRSP x BN Map1133.51RGD
Cytogenetic Map1q54UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   DRH.F344-(D1Mgh8-D1Mgh12)/Shigm  
QTLs:   Eae7   Rf1   Bp42   Niddm24   Bw20   Iddm9   Hcar6   Bw39   Bw45   Bw42   Hcar15   Bp259   Kidm22   Rf52   Edcs4   Bw83   Insul11  
Genes:   Got1   Rf1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GCTTGCTGTACAAACCTCAGG
Reverse Primer CAGCACGGAAGATACAAGCA
 

Region



Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302761 UniSTS
  100302772 UniSTS
  100302839 UniSTS
  100302992 UniSTS
  100303164 UniSTS
  100303244 UniSTS
  100303403 UniSTS
  24401 UniSTS
  246064 UniSTS
  326350 UniSTS
  326364 UniSTS
  326489 UniSTS
  326537 UniSTS
  369167 UniSTS
  387417 UniSTS
  544604 UniSTS
  544644 UniSTS
  544649 UniSTS
NCBI Nucleotide S65119
UniSTS 121448 UniSTS