D10Wox22 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Wox22

Symbol: D10Wox22
Previously known as: oxsts5374; RATGHGP/GHGP; R3; RATGHGP; 
RGD ID: 10641
Expected Size: 157 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01094,240,348 - 94,240,491NCBIRnor5.0
RGSC_v3.41095,695,076 - 95,695,218RGDRGSC3.4
RH 3.4 Map10981.5RGD
RH 3.4 Map10981.5UniSTS
RH 2.0 Map101084.0RGD
Cytogenetic Map10 RGD
Is Marker For: Strains:   DA.F344-(D10Rat204-D10Arb22)/Arb  
QTLs:   Ciaa2   Cia29  
Genes:   Ciaa2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer ATGGGAGGGAACAAGTCTTC
Reverse Primer GAGGGAGAGAGAAAGAGAGACAG
 

Region

Nucleotide Sequences
GenBank Nucleotide X12967 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100302811 UniSTS
  24263 UniSTS
NCBI Nucleotide X12967