D8Mgh13 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mgh13

Symbol: D8Mgh13
Previously known as: oxsts9206; 
RGD ID: 10437
Expected Size: 124 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RGSC_v3.4861,443,447 - 61,443,567RGDRGSC3.4
RGSC_v3.4861,443,448 - 61,443,566UniSTSRGSC3.4
RGSC_v3.1861,462,501 - 61,462,621RGD
RH 3.4 Map8664.2UniSTS
RH 3.4 Map8664.2RGD
RH 2.0 Map8523.1RGD
Cytogenetic Map8q24UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Mcs4  
Genes:   Cyp1a2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. Genetic identification of multiple loci that control breast cancer susceptibility in the rat Shepel LA, etal., Genetics 1998 May;149(1):289-99
6. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TTCTGTTGAGACTCAGTCCTTCC
Reverse Primer TTTTTAACCATTCAACACAAATGG
 

Region

Nucleotide Sequences
GenBank Nucleotide K03241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 24297 UniSTS
  326387 UniSTS
UniSTS 120529 UniSTS