D19Mit6 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19Mit6

Symbol: D19Mit6
Also known as: oxsts8970; D19Wox7; oxsts5728; R135; 
RGD ID: 10418
Expected Size: 144 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21939,654,377 - 39,654,489 (+)MAPPER
Rnor_6.01943,907,732 - 43,907,843NCBIRnor6.0
Rnor_5.01954,715,403 - 54,715,514UniSTSRnor5.0
RGSC_v3.41941,612,770 - 41,612,881UniSTSRGSC3.4
RGSC_v3.11941,617,650 - 41,617,762RGD
RH 3.4 Map19489.9RGD
RH 3.4 Map19489.9UniSTS
RH 2.0 Map19550.3RGD
Cytogenetic Map19q12UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   WF.DA-(D19Mit1-D19Mit6)/Kop   COP/OlaHsd  
QTLs:   Tcas5   Tcas7   Eau8  
Genes:   Ctrb1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CAGTGACCCCCCACTGTT
Reverse Primer GTGTGTCATAAGAGAGCTACAATGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2444Ctrb1chymotrypsinogen B1194390634443911020Rat

Nucleotide Sequences
GenBank Nucleotide JH619497 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  K02298 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19104464846044648Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19195770746957707Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19243296347217667Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19243296362275575Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)19370183548701835Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)19370183548701835Rat
724565Tcas5Tongue tumor susceptibility QTL 510.04tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)19500757143907843Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19650676160220581Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19807254547318201Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191130392747879277Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191702800352538299Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191899398262275575Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191917749562275575Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)192140778762275575Rat
1549835Tcas7Tongue tumor susceptibility QTL 70.001tongue integrity trait (VT:0010553)squamous cell carcinoma of the head and neck tumor number (CMO:0001876)192445572643907843Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192481825762275575Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)193299439262275575Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193791679960220451Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum insulin level (CMO:0000358)193791679960220451Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100302781 UniSTS
  100303413 UniSTS
  24291 UniSTS
  387480 UniSTS
UniSTS 118076 UniSTS