D11Mgh1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: D11Mgh1

Symbol: D11Mgh1
Previously known as: R1102-C04; CATOMT5; 5CATOMT; oxsts8820; 
RGD ID: 10375
Expected Size: 148 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21182,566,553 - 82,566,702 (+)MAPPERmRatBN7.2
Rnor_6.01186,714,483 - 86,714,631NCBIRnor6.0
Rnor_5.01189,808,355 - 89,808,503UniSTSRnor5.0
RGSC_v3.41184,560,092 - 84,560,241RGDRGSC3.4
RGSC_v3.41184,560,093 - 84,560,241UniSTSRGSC3.4
RGSC_v3.11184,600,689 - 84,600,838RGD
Celera1181,343,623 - 81,343,771UniSTS
SHRSP x BN Map1138.1899UniSTS
SHRSP x BN Map1138.1899RGD
FHH x ACI Map1157.2499RGD
Cytogenetic Map11q23UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd   F344.OLETF-(D11Mgh4-D11Mgh1)/Tj   F344.OLETF-(D11Mgh4-D11Mgh1)/2Tj  
QTLs:   Niddm22   Stl7   Rf19   Glom20  
Genes:   Comt   Txnrd2  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GGTGGCTCTTCATCCTAGCA
Reverse Primer ACTCTGAGACTCTTGACTGTGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
61960Txnrd2thioredoxin reductase 2118251999682568156Rat

Nucleotide Sequences
GenBank Nucleotide Z12652 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat
1300135Rf19Renal function QTL 193.38blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)114094618882566702Rat
2312566Glom20Glomerulus QTL 203.60.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)114428575982566702Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
4889521Gluco62Glucose level QTL 622.820.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)115513672982993457Rat
7411658Foco27Food consumption QTL 2716.20.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)115635142486241447Rat
70208Niddm22Non-insulin dependent diabetes mellitus QTL 223.61blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)115980279482566553Rat
10058954Gmadr7Adrenal mass QTL 72.490.0049adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)116034659086241447Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)116642214886241447Rat
1354593Stl12Serum triglyceride level QTL 123.36blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)116642214886241447Rat
1354656Bvd3Brain ventricular dilatation QTL 33.640.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116944607082846715Rat
10450831Scl80Serum cholesterol level QTL 804.70.01blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)117695713183051965Rat
2302043Pia27Pristane induced arthritis QTL 2718.60.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)118256654583440803Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303443 UniSTS
  24267 UniSTS
  326534 UniSTS
  444909 UniSTS
  444934 UniSTS
  50551 UniSTS
NCBI Nucleotide Z12562
UniSTS 119429 UniSTS