D14Wox8 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Wox8

Symbol: D14Wox8
Previously known as: R43; Afp; RATAFPGA; oxsts5544; 
RGD ID: 10114
Expected Size: 151 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RH 3.4 Map14224.4UniSTS
RH 3.4 Map14224.4RGD
RH 2.0 Map14212.6RGD
Cytogenetic Map14p21UniSTS
Is Marker For: Strains:   DA.E3-(D14Wox8-D14Rat64)/Rhd  
Genes:   Afp  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AAGCATAGCAGTGAATTGGTG
Reverse Primer TTCATCATCCTTTCATAAAGGC
 

Region

Nucleotide Sequences
GenBank Nucleotide M18351 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X68548 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24177 UniSTS
NCBI Nucleotide M18351
UniSTS 119423 UniSTS