Mir669f (microRNA 669f) - Rat Genome Database

Name: Mir669f
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Welcome {{ username}}

Message Center

{{ messageCount }} Messages

Go to Message Center

Watched Genes

{{$index + 1}}. {{ watchedObject.symbol }} (RGD ID:{{watchedObject.rgdId}})

Update Watcher

Remove Watcher

Watched Ontology Terms

{{$index + 1}}. {{ watchedTerm.term }} ({{watchedTerm.accId}})

Update Watcher

Remove Watcher

{{gene.symbol}}: {{ gene.description }}

Save List to My RGD

Create Name:

Description:

Save what matters to you

Email Address:

Password:

Create New Account

Recover Password

Select categories you would like to watch. Updates to this gene will be send to {{ username }}

Analyze GeneStrainQTL List

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: Mir669f (microRNA 669f) Mus musculus

Analyze

General
Array IDs
References

Symbol:

Mir669f

Name:

microRNA 669f

Description:

Involved in cellular response to amino acid stimulus. Localizes to the RISC complex.

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

Mirn669f; mmu-mir-669f

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	2	10,467,229 - 10,467,349 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Cytogenetic Map	2	A1	NCBI
cM Map	2	8.22	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
choline	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR669F mRNA	CTD	PMID:20548288
folic acid	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR669F mRNA	CTD	PMID:20548288
L-methionine	multiple interactions	EXP		6480464	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of MIR669F mRNA	CTD	PMID:20548288
sodium fluoride	increases expression	EXP		6480464	Sodium Fluoride results in increased expression of MIR669F mRNA	CTD	PMID:29127033

Gene Ontology Annotations

Biological Process

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
cellular response to amino acid stimulus		IDA		2290270	(MGI:MGI:4833768, PMID:20548288)	MGI	MGI:MGI:4833768, PMID:20548288

Cellular Component

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RISC complex		IDA		2290270	(MGI:MGI:5507918, PMID:23185045)	MGI	MGI:MGI:5507918, PMID:23185045

Gene-Chemical Interaction Annotations

	choline (EXP)
	folic acid (EXP)

	L-methionine (EXP)
	sodium fluoride (EXP)

Gene Ontology Annotations

Biological Process

cellular response to amino acid stimulus (IDA)

Cellular Component

RISC complex (IDA)

References - curated

1.	RGD automated import pipeline for gene-chemical interactions

References - uncurated

PubMed

16381832 17989215 20413612 20548288 20668074 23185045 24931612

Genomics

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10045633	Heal15_m	wound healing/regeneration 15 (mouse)			Not determined		2	1	21984831	Mouse
4142333	Tgq10_m	triglyceride QTL 10 (mouse)			Not determined			1	25319748	Mouse
4141836	Tgq11_m	triglyceride QTL 11 (mouse)			Not determined			1	25319748	Mouse
1301838	Sluc16_m	susceptibility to lung cancer 16 (mouse)			Not determined		2	1	26524778	Mouse
12904743	Carcdq3_m	cardiac collagen deposition QTL 3 (mouse)					2	3233903	28289138	Mouse
1301769	Orgwq2_m	organ weight QTL 2 (mouse)			Not determined		2	3886089	93591306	Mouse
1301980	Fcsa5_m	femoral cross-sectional area 5 (mouse)			Not determined		2	7789103	41789249	Mouse
1301790	Pcfm1_m	periosteal circumference and femur length 1 (mouse)			Not determined		2	8346284	42346384	Mouse
10043876	Adip22_m	adiposity 22 (mouse)			Not determined		2	8418039	42418228	Mouse
1300624	Insq7_m	insulin QTL 7 (mouse)			Not determined		2	9494434	43494563	Mouse
10755513	Amzn4_m	anatomical modifier of Zfp423 4 (mouse)					2	9494434	43494563	Mouse
12903993	Opfaq1_m	open field activity QTL 1 (mouse)					2	9671880	27132630	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	30349
Count of gene targets:	10047
Count of transcripts:	17289
Interacting mature miRNAs:	mmu-miR-669f-3p, mmu-miR-669f-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NR_130324	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL772216	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_130324

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	2	10,467,229 - 10,467,349 (+)	NCBI

Sequence:

show sequence

TGTATGTGCCTGTGTGTATAGTTGTGTGTGCATGTGCATGTGTGTATATGAATATACATATACA
TACACACACACGTATAAACGCAAGCACAAACACACACAGAGGAATGGCACTCGTTGA

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000077038	ENTREZGENE
Ensembl Transcript	ENSMUST00000103850	ENTREZGENE
MGD	MGI:3783384	ENTREZGENE
miRBase	MI0006287	ENTREZGENE
NCBI Gene	Mir669f	ENTREZGENE
PhenoGen	Mir669f	PhenoGen
RNAcentral	URS00000BC03C	RNACentral
	URS00004C89DD	RNACentral
	URS000078D701	RNACentral

More on Mir669f
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: mm10
	MGI Report
	NCBI Genome Data Viewer

RGD Object Information
RGD ID:	9686153
Created:	2015-02-03
Species:	Mus musculus
Last Modified:	2019-09-12
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.