Mir6896 (microRNA 6896) - Rat Genome Database

Name: Mir6896
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir6896 (microRNA 6896) Mus musculus

Analyze

Symbol:

Mir6896

Name:

microRNA 6896

RGD ID:

9680703

MGI Page

MGI

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mmu-mir-6896

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	34,156,440 - 34,156,512 (+)	NCBI	GRCm39		mm39
GRCm38	1	34,117,359 - 34,117,431 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	34,117,359 - 34,117,431 (+)	Ensembl	GRCm38		mm10	GRCm38
Celera	1	33,887,726 - 33,887,798 (+)	NCBI		Celera
Cytogenetic Map	1	B	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

References

Additional References at PubMed

PMID:16381832	PMID:22955976

Genomics

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301275	Sle10_m	systematic lupus erythematosus susceptibility 10 (mouse)			Not determined		1	2811970	36812128	Mouse
1301370	Adip1_m	adiposity 1 (mouse)			Not determined		1	2811970	36812128	Mouse
13824984	Twq5_m	testis weight QTL 5 (mouse)					1	3000000	185000000	Mouse
1301471	Obq2_m	obesity QTL 2 (mouse)			Not determined		1	3871396	37871663	Mouse
10043970	Obq23_m	obesity QTL 23 (mouse)			Not determined		1	4942441	38942441	Mouse
1301011	Cplaq4_m	circadian period of locomotor activity 4 (mouse)			Not determined		1	9634361	43634520	Mouse
14700685	Civq2_m	cerebral infarct volume QTL 2 (mouse)					1	11301401	45301401	Mouse
1301240	Sluc15_m	susceptibility to lung cancer 15 (mouse)			Not determined		1	19026270	53026373	Mouse
1301073	Orch5_m	autoimmune orchitis resistance 5 (mouse)			Not determined		1	19026270	53026373	Mouse
1301756	Pgia1_m	proteoglycan induced arthritis 1 (mouse)			Not determined		1	19026270	53026373	Mouse
12880407	V125Dq2_m	vitamin D active form serum level QTL 2 (mouse)					1	19300000	53300000	Mouse
1357475	w3q13_m	weight 3 weeks QTL 13 (mouse)			Not determined		1	23070510	73937756	Mouse
4142433	Hbnr1_m	Heligmosomoides bakeri nematode resistance 1 (mouse)			Not determined			25511110	58234112	Mouse
11100001	Col4a1m1_m	collagen, type IV, alpha 1 modifier 1 (mouse)					1	25511110	62907723	Mouse
12880409	V125Dq1_m	vitamin D active form serum level QTL 1 (mouse)					1	26000000	60000000	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	25154
Count of gene targets:	8801
Count of transcripts:	13884
Interacting mature miRNAs:	mmu-miR-6896-3p, mmu-miR-6896-5p
Prediction methods:	Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_105861	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC127433	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000198033

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	1	34,117,359 - 34,117,431 (+)	Ensembl

RefSeq Acc Id:

NR_105861

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	1	34,156,440 - 34,156,512 (+)	NCBI
GRCm38	1	34,117,359 - 34,117,431 (+)	NCBI
Celera	1	33,887,726 - 33,887,798 (+)	NCBI

Sequence:

show sequence

TTTCCTTTGTAGGCGACGAGAACCCGTGCCTGGTGTGTAATAATCACTGTTTCTCTCTCTCACC
TACAAACAG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000105982	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000198033	ENTREZGENE
MGD	MGI:5562721	ENTREZGENE
miRBase	MI0022743	ENTREZGENE
NCBI Gene	Mir6896	ENTREZGENE
PhenoGen	Mir6896	PhenoGen
RNAcentral	URS000075CB01	RNACentral
	URS000075D539	RNACentral
	URS000075EC92	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)