Mir219b (microRNA 219b) - Rat Genome Database

Name: Mir219b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir219b (microRNA 219b) Mus musculus

Analyze

Symbol:

Mir219b

Name:

microRNA 219b

RGD ID:

9620836

MGI Page

MGI

Description:

Orthologous to human MIR219B (microRNA 219b).

Type:

ncrna

RefSeq Status:

PROVISIONAL

Also known as:

mmu-mir-219b

RGD Orthologs

Human

Rat

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm38 - Mouse Genome Assembly GRCm38

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	29,735,659 - 29,735,723 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	2	29,735,659 - 29,735,723 (+)	Ensembl
GRCm38	2	29,845,647 - 29,845,711 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	29,845,647 - 29,845,711 (+)	Ensembl	GRCm38		mm10	GRCm38
Celera	2	29,552,741 - 29,552,805 (+)	NCBI		Celera
Cytogenetic Map	2	B	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

developmental and epileptic encephalopathy 1 (ISO)

primary coenzyme Q10 deficiency 7 (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

monocrotaline (EXP)

vinclozolin (ISO)

References

Additional References at PubMed

PMID:16381832	PMID:23325850

Genomics

Comparative Map Data

Mir219b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	2	29,735,659 - 29,735,723 (+)	NCBI	GRCm39		mm39
GRCm39 Ensembl	2	29,735,659 - 29,735,723 (+)	Ensembl
GRCm38	2	29,845,647 - 29,845,711 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	2	29,845,647 - 29,845,711 (+)	Ensembl	GRCm38		mm10	GRCm38
Celera	2	29,552,741 - 29,552,805 (+)	NCBI		Celera
Cytogenetic Map	2	B	NCBI

MIR219B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	9	128,392,621 - 128,392,708 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	9	128,392,621 - 128,392,708 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	9	131,154,900 - 131,154,987 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Cytogenetic Map	9	q34.11	NCBI
HuRef	9	100,767,723 - 100,767,810 (+)	NCBI		HuRef
CHM1_1	9	131,305,925 - 131,306,012 (+)	NCBI		CHM1_1

Mir2964
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	3	13,118,623 - 13,118,722 (+)	NCBI
Rnor_6.0 Ensembl	3	8,407,427 - 8,407,526 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_6.0	3	8,407,427 - 8,407,526 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	3	13,750,973 - 13,751,072 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	3	7,896,042 - 7,896,141 (+)	NCBI		Celera
Cytogenetic Map	3	p12	NCBI

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301769	Orgwq2_m	organ weight QTL 2 (mouse)			Not determined		2	3886089	93591306	Mouse
1301980	Fcsa5_m	femoral cross-sectional area 5 (mouse)			Not determined		2	7789103	41789249	Mouse
1301790	Pcfm1_m	periosteal circumference and femur length 1 (mouse)			Not determined		2	8346284	42346384	Mouse
10043876	Adip22_m	adiposity 22 (mouse)			Not determined		2	8418039	42418228	Mouse
1300624	Insq7_m	insulin QTL 7 (mouse)			Not determined		2	9494434	43494563	Mouse
10755513	Amzn4_m	anatomical modifier of Zfp423 4 (mouse)					2	9494434	43494563	Mouse
8552707	Cia23_m	collagen induced arthritis QTL 23 (mouse)			Not determined		2	12124726	66726109	Mouse
1301641	Sbmd2_m	spinal bone mineral density 2 (mouse)			Not determined		2	14324555	48324701	Mouse
1357454	Kidq1_m	kidney weight QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1357436	Splq1_m	spleen weight QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1357829	Lvrq1_m	liver weight QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1558899	Egq1_m	early growth QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1558738	W6q1_m	weight 6 weeks QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1558966	W10q9_m	weight 10 weeks QTL 9 (mouse)			Not determined		2	20892967	119064359	Mouse
1558915	W3q1_m	weight 3 weeks QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1357681	Hrtq1_m	heart weight QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
1357881	Estoq1_m	embryo survival total QTL 1 (mouse)			Not determined		2	20892967	119064359	Mouse
39128209	Lwq14_m	liver weight QTL 14 (mouse)					2	20892967	119064359	Mouse
4141708	Pbwg1.2_m	postnatal body weight growth 1.2 (mouse)			Not determined			21239713	55239859	Mouse
1301376	Etohc1_m	ethanol consumption 1 (mouse)			Not determined		2	21239713	55239859	Mouse
13463470	Tubisq1_m	tubulointerstitial injury severity, QTL 1 (mouse)					2	23799133	57799257	Mouse
1302174	Dssc2_m	dextran sodium sulfate induced colitis QTL2 (mouse)			Not determined		2	24334620	148858457	Mouse
26884438	Sklq12_m	skull length QTL 12, 16 week (mouse)					2	24700000	55000000	Mouse
8552705	Cia25_m	collagen induced arthritis 25 (mouse)			Not determined		2	24789103	33633160	Mouse
8552706	Cia24_m	collagen induced arthritis QTL 24 (mouse)			Not determined		2	24789103	33633160	Mouse
4142130	Pgis2_m	proteoglycan induced spondylitis 2 (mouse)			Not determined		2	25418039	57081799	Mouse
12904005	Cfq2_m	conditioned fear QTL 2 (mouse)					2	27132630	56506216	Mouse
1300577	Capsq1_m	capsaicin sensitivity related QTL 1 (mouse)			Not determined		2	27712048	84183040	Mouse
14746979	Manh51_m	mandible shape 51 (mouse)					2	29071117	63071117	Mouse
14746997	Mancz2_m	mandible centroid size 2 (mouse)					2	29071117	63071117	Mouse
4141854	T2dm2sa_m	type 2 diabetes mellitus 2 in SMXA RI mice (mouse)			Not determined		2	29417935	148533014	Mouse

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	8340
Count of gene targets:	4355
Count of transcripts:	6363
Interacting mature miRNAs:	mmu-miR-219b-3p, mmu-miR-219b-5p
Prediction methods:	Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_106110	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL928926	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSMUST00000198317

RefSeq Status:

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38.p6 Ensembl	2	29,845,647 - 29,845,711 (+)	Ensembl

RefSeq Acc Id:

NR_106110

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	2	29,735,659 - 29,735,723 (+)	NCBI
GRCm38	2	29,845,647 - 29,845,711 (+)	NCBI
Celera	2	29,552,741 - 29,552,805 (+)	NCBI

Sequence:

show sequence

AGATGTCCAGCCACAATTCTCGGTTGGCCGCAGACTCGTACAAGAATTGCGTTTGGACAATCAG
T

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:5562756	AgrOrtholog
Ensembl Genes	ENSMUSG00000105010	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000198317	ENTREZGENE
MGD	MGI:5562756	ENTREZGENE
miRBase	MI0024990	ENTREZGENE
NCBI Gene	Mir219b	ENTREZGENE
PhenoGen	Mir219b	PhenoGen
RNAcentral	URS0000527B00	RNACentral
	URS0000603CA3	RNACentral
	URS000075EC5E	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar