|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
# | Reference Title | Reference Citation |
1. | Regulators of Iron Homeostasis: New Players in Metabolism, Cell Death, and Disease. | Bogdan AR, etal., Trends Biochem Sci. 2016 Mar;41(3):274-86. doi: 10.1016/j.tibs.2015.11.012. Epub 2015 Dec 23. |
2. | GOAs Human GO annotations | GOA_HUMAN data from the GO Consortium |
3. | Creutzfeldt-Jacob disease associated with the PRNP codon 200Lys mutation: an analysis of 45 families. | Goldfarb LG, etal., Eur J Epidemiol. 1991 Sep;7(5):477-86. |
4. | A novel vector for transgenesis in the rat CNS. | Lopez TP, etal., Acta Neuropathol Commun. 2017 Nov 21;5(1):84. doi: 10.1186/s40478-017-0484-y. |
5. | OMIM Disease Annotation Pipeline | OMIM Disease Annotation Pipeline |
6. | KEGG Annotation Import Pipeline | Pipeline to import KEGG annotations from KEGG into RGD |
7. | PID Annotation Import Pipeline | Pipeline to import Pathway Interaction Database annotations from NCI into RGD |
8. | ClinVar Automated Import and Annotation Pipeline | RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations |
9. | Data Import for Chemical-Gene Interactions | RGD automated import pipeline for gene-chemical interactions |
10. | RGD HPO Phenotype Annotation Pipeline | RGD automated import pipeline for human HPO-to-gene-to-disease annotations |
11. | Pronounced cytosolic aggregation of cellular prion protein in pancreatic beta-cells in response to hyperglycemia. | Strom A, etal., Lab Invest. 2006 Dec 4;. |
PMID:1346338 | PMID:1347910 | PMID:1351748 | PMID:1352724 | PMID:1357663 | PMID:1363802 | PMID:1363810 | PMID:1439789 | PMID:1671440 | PMID:1672107 | PMID:1677164 | PMID:1678248 |
PMID:1683708 | PMID:1736177 | PMID:2159587 | PMID:2180366 | PMID:2564168 | PMID:2567794 | PMID:2572450 | PMID:2783132 | PMID:3014653 | PMID:3755672 | PMID:7485229 | PMID:7572084 |
PMID:7592679 | PMID:7630420 | PMID:7642585 | PMID:7699395 | PMID:7783876 | PMID:7902693 | PMID:7902972 | PMID:7906019 | PMID:7913755 | PMID:8105771 | PMID:8364585 | PMID:8461023 |
PMID:8676499 | PMID:8797471 | PMID:8797472 | PMID:8909447 | PMID:8962161 | PMID:9266722 | PMID:9384372 | PMID:9473220 | PMID:9482303 | PMID:9786248 | PMID:9799790 | PMID:10090891 |
PMID:10581485 | PMID:10618385 | PMID:10631141 | PMID:10790216 | PMID:10900000 | PMID:10954699 | PMID:10970892 | PMID:10987652 | PMID:10988071 | PMID:11032800 | PMID:11032878 | PMID:11060296 |
PMID:11062072 | PMID:11100730 | PMID:11120925 | PMID:11161453 | PMID:11220690 | PMID:11244488 | PMID:11278562 | PMID:11283320 | PMID:11438139 | PMID:11559357 | PMID:11571277 | PMID:11584448 |
PMID:11593450 | PMID:11684342 | PMID:11704923 | PMID:11709001 | PMID:11756421 | PMID:11775001 | PMID:11780052 | PMID:11787070 | PMID:11833672 | PMID:11840201 | PMID:11882649 | PMID:11900542 |
PMID:11961239 | PMID:11986958 | PMID:12034503 | PMID:12070046 | PMID:12084159 | PMID:12093732 | PMID:12161431 | PMID:12186633 | PMID:12205650 | PMID:12356762 | PMID:12356908 | PMID:12359724 |
PMID:12392052 | PMID:12399017 | PMID:12459456 | PMID:12464104 | PMID:12477932 | PMID:12514748 | PMID:12543108 | PMID:12547204 | PMID:12568340 | PMID:12590162 | PMID:12601712 | PMID:12621436 |
PMID:12645301 | PMID:12659837 | PMID:12679034 | PMID:12679875 | PMID:12682740 | PMID:12684540 | PMID:12690204 | PMID:12692258 | PMID:12694397 | PMID:12719777 | PMID:12778138 | PMID:12796830 |
PMID:12805563 | PMID:12867116 | PMID:12917418 | PMID:12917444 | PMID:12946346 | PMID:12952977 | PMID:12970341 | PMID:14519851 | PMID:14576159 | PMID:14593432 | PMID:14610121 | PMID:14616310 |
PMID:14623188 | PMID:14645231 | PMID:14668351 | PMID:14702039 | PMID:14744790 | PMID:14745079 | PMID:14761942 | PMID:14970845 | PMID:14983221 | PMID:15050367 | PMID:15123682 | PMID:15131108 |
PMID:15140132 | PMID:15145944 | PMID:15146195 | PMID:15148589 | PMID:15203115 | PMID:15208260 | PMID:15215178 | PMID:15247220 | PMID:15258222 | PMID:15266305 | PMID:15277640 | PMID:15304595 |
PMID:15342556 | PMID:15469448 | PMID:15488240 | PMID:15489334 | PMID:15539564 | PMID:15555583 | PMID:15557533 | PMID:15583862 | PMID:15591591 | PMID:15609351 | PMID:15639746 | PMID:15684434 |
PMID:15748158 | PMID:15775715 | PMID:15837581 | PMID:15846375 | PMID:15850959 | PMID:15862295 | PMID:15946217 | PMID:15987701 | PMID:15997418 | PMID:16004966 | PMID:16009550 | PMID:16025285 |
PMID:16051190 | PMID:16099550 | PMID:16099923 | PMID:16119432 | PMID:16120605 | PMID:16156720 | PMID:16159877 | PMID:16169070 | PMID:16175355 | PMID:16187142 | PMID:16192387 | PMID:16215457 |
PMID:16215462 | PMID:16217673 | PMID:16254249 | PMID:16263114 | PMID:16286452 | PMID:16287045 | PMID:16294306 | PMID:16298483 | PMID:16314483 | PMID:16315279 | PMID:16324095 | PMID:16342955 |
PMID:16344560 | PMID:16432880 | PMID:16434486 | PMID:16443601 | PMID:16460908 | PMID:16478730 | PMID:16519692 | PMID:16533975 | PMID:16537913 | PMID:16543824 | PMID:16545382 | PMID:16547836 |
PMID:16580884 | PMID:16582585 | PMID:16672189 | PMID:16674609 | PMID:16704797 | PMID:16713569 | PMID:16750169 | PMID:16764594 | PMID:16824036 | PMID:16825951 | PMID:16825956 | PMID:16831968 |
PMID:16847141 | PMID:16847689 | PMID:16858508 | PMID:16889908 | PMID:16897605 | PMID:16908519 | PMID:16914329 | PMID:16921242 | PMID:16925523 | PMID:16934224 | PMID:16950206 | PMID:16987816 |
PMID:17023178 | PMID:17029361 | PMID:17047093 | PMID:17092648 | PMID:17121821 | PMID:17134829 | PMID:17149767 | PMID:17156017 | PMID:17192785 | PMID:17202849 | PMID:17242357 | PMID:17260961 |
PMID:17276393 | PMID:17313881 | PMID:17334659 | PMID:17385076 | PMID:17409275 | PMID:17410475 | PMID:17414209 | PMID:17449139 | PMID:17472702 | PMID:17497959 | PMID:17500595 | PMID:17519231 |
PMID:17539938 | PMID:17559305 | PMID:17560545 | PMID:17570906 | PMID:17709704 | PMID:17822808 | PMID:17827389 | PMID:17873292 | PMID:17965961 | PMID:17987393 | PMID:17996224 | PMID:18006836 |
PMID:18025469 | PMID:18029348 | PMID:18038270 | PMID:18051367 | PMID:18188498 | PMID:18191917 | PMID:18204788 | PMID:18217885 | PMID:18218718 | PMID:18236005 | PMID:18236081 | PMID:18247504 |
PMID:18275852 | PMID:18325785 | PMID:18332630 | PMID:18347820 | PMID:18349519 | PMID:18372408 | PMID:18406463 | PMID:18413481 | PMID:18419754 | PMID:18423780 | PMID:18425766 | PMID:18436646 |
PMID:18443555 | PMID:18445040 | PMID:18478114 | PMID:18482256 | PMID:18505059 | PMID:18508914 | PMID:18539633 | PMID:18549395 | PMID:18549399 | PMID:18563793 | PMID:18597782 | PMID:18619462 |
PMID:18638557 | PMID:18665216 | PMID:18691383 | PMID:18706660 | PMID:18720902 | PMID:18722532 | PMID:18786636 | PMID:18810471 | PMID:18830724 | PMID:18930924 | PMID:18955686 | PMID:18959744 |
PMID:18990686 | PMID:19008948 | PMID:19010951 | PMID:19030774 | PMID:19035579 | PMID:19051123 | PMID:19056496 | PMID:19056867 | PMID:19064990 | PMID:19074151 | PMID:19077115 | PMID:19081515 |
PMID:19099191 | PMID:19129193 | PMID:19140013 | PMID:19156168 | PMID:19158507 | PMID:19164910 | PMID:19172188 | PMID:19196429 | PMID:19204171 | PMID:19204296 | PMID:19210573 | PMID:19212444 |
PMID:19218199 | PMID:19226372 | PMID:19228673 | PMID:19242475 | PMID:19249347 | PMID:19278656 | PMID:19321423 | PMID:19327369 | PMID:19351416 | PMID:19363267 | PMID:19369250 | PMID:19416900 |
PMID:19476383 | PMID:19477226 | PMID:19495414 | PMID:19524515 | PMID:19534429 | PMID:19542614 | PMID:19556894 | PMID:19558790 | PMID:19581412 | PMID:19583442 | PMID:19587281 | PMID:19597535 |
PMID:19601795 | PMID:19602567 | PMID:19606064 | PMID:19607920 | PMID:19643043 | PMID:19675240 | PMID:19690385 | PMID:19696976 | PMID:19697238 | PMID:19698114 | PMID:19709627 | PMID:19710507 |
PMID:19725833 | PMID:19728151 | PMID:19734292 | PMID:19786843 | PMID:19807656 | PMID:19822779 | PMID:19882604 | PMID:19889475 | PMID:19910028 | PMID:19911184 | PMID:19917818 | PMID:19923577 |
PMID:19927125 | PMID:19996123 | PMID:20004419 | PMID:20005032 | PMID:20028338 | PMID:20035629 | PMID:20036811 | PMID:20036833 | PMID:20049591 | PMID:20077484 | PMID:20105449 | PMID:20109837 |
PMID:20145049 | PMID:20175205 | PMID:20195363 | PMID:20198483 | PMID:20301407 | PMID:20392961 | PMID:20413850 | PMID:20422111 | PMID:20453509 | PMID:20465257 | PMID:20473510 | PMID:20487506 |
PMID:20506117 | PMID:20515742 | PMID:20515743 | PMID:20515747 | PMID:20526338 | PMID:20526696 | PMID:20529115 | PMID:20541558 | PMID:20547212 | PMID:20547859 | PMID:20552563 | PMID:20562404 |
PMID:20564047 | PMID:20564346 | PMID:20573963 | PMID:20574532 | PMID:20576610 | PMID:20583301 | PMID:20583902 | PMID:20592456 | PMID:20593190 | PMID:20613639 | PMID:20650901 | PMID:20661422 |
PMID:20685658 | PMID:20694796 | PMID:20711061 | PMID:20718410 | PMID:20724601 | PMID:20799315 | PMID:20804519 | PMID:20816195 | PMID:20837487 | PMID:20838930 | PMID:20861579 | PMID:20870462 |
PMID:20880607 | PMID:20919751 | PMID:20923664 | PMID:20930299 | PMID:20932979 | PMID:20949975 | PMID:20964628 | PMID:20970434 | PMID:21029243 | PMID:21058033 | PMID:21062360 | PMID:21071944 |
PMID:21094273 | PMID:21107135 | PMID:21107851 | PMID:21116546 | PMID:21119307 | PMID:21193246 | PMID:21209079 | PMID:21212268 | PMID:21232818 | PMID:21257747 | PMID:21265952 | PMID:21293298 |
PMID:21296677 | PMID:21297264 | PMID:21298055 | PMID:21301993 | PMID:21320996 | PMID:21323366 | PMID:21338080 | PMID:21356381 | PMID:21385869 | PMID:21439722 | PMID:21445238 | PMID:21451573 |
PMID:21453198 | PMID:21478263 | PMID:21478678 | PMID:21508834 | PMID:21552571 | PMID:21559407 | PMID:21593310 | PMID:21597335 | PMID:21600043 | PMID:21616973 | PMID:21631281 | PMID:21654203 |
PMID:21689534 | PMID:21743439 | PMID:21763357 | PMID:21795680 | PMID:21799773 | PMID:21804240 | PMID:21827207 | PMID:21833705 | PMID:21839748 | PMID:21841253 | PMID:21857997 | PMID:21873635 |
PMID:21875156 | PMID:21900252 | PMID:21911696 | PMID:21920025 | PMID:21943430 | PMID:21957246 | PMID:21957261 | PMID:21980292 | PMID:21980981 | PMID:21983261 | PMID:22002245 | PMID:22028931 |
PMID:22031292 | PMID:22032174 | PMID:22036844 | PMID:22046086 | PMID:22076653 | PMID:22128151 | PMID:22129783 | PMID:22137330 | PMID:22155634 | PMID:22184125 | PMID:22210626 | PMID:22252492 |
PMID:22285492 | PMID:22293988 | PMID:22318125 | PMID:22356913 | PMID:22363722 | PMID:22384235 | PMID:22411239 | PMID:22484317 | PMID:22505365 | PMID:22511770 | PMID:22558368 | PMID:22561193 |
PMID:22584955 | PMID:22612156 | PMID:22615124 | PMID:22658899 | PMID:22669942 | PMID:22675855 | PMID:22676969 | PMID:22685557 | PMID:22763467 | PMID:22788868 | PMID:22791135 | PMID:22796214 |
PMID:22820080 | PMID:22820466 | PMID:22842913 | PMID:22860629 | PMID:22861352 | PMID:22874673 | PMID:22876179 | PMID:22895088 | PMID:22895089 | PMID:22915585 | PMID:22918447 | PMID:22930754 |
PMID:22967749 | PMID:22972305 | PMID:22978166 | PMID:22987042 | PMID:23022479 | PMID:23090399 | PMID:23115236 | PMID:23131565 | PMID:23209282 | PMID:23225001 | PMID:23225009 | PMID:23225390 |
PMID:23236467 | PMID:23256626 | PMID:23276223 | PMID:23283514 | PMID:23319218 | PMID:23324596 | PMID:23376485 | PMID:23386614 | PMID:23392670 | PMID:23398456 | PMID:23399523 | PMID:23405858 |
PMID:23406905 | PMID:23406923 | PMID:23436635 | PMID:23449776 | PMID:23467330 | PMID:23565236 | PMID:23577068 | PMID:23614720 | PMID:23625312 | PMID:23627023 | PMID:23637596 | PMID:23638794 |
PMID:23764834 | PMID:23785217 | PMID:23787697 | PMID:23792955 | PMID:23825952 | PMID:23843953 | PMID:23857314 | PMID:23857619 | PMID:23907583 | PMID:23911565 | PMID:23959875 | PMID:23967259 |
PMID:23974118 | PMID:24012003 | PMID:24028865 | PMID:24047819 | PMID:24086135 | PMID:24091711 | PMID:24112521 | PMID:24121542 | PMID:24145555 | PMID:24224623 | PMID:24225951 | PMID:24329154 |
PMID:24338015 | PMID:24360565 | PMID:24390569 | PMID:24398683 | PMID:24493558 | PMID:24498083 | PMID:24519981 | PMID:24606939 | PMID:24620982 | PMID:24623722 | PMID:24706505 | PMID:24714645 |
PMID:24838726 | PMID:24857020 | PMID:24945274 | PMID:24958194 | PMID:24965601 | PMID:24970228 | PMID:25027605 | PMID:25148681 | PMID:25220284 | PMID:25239885 | PMID:25279981 | PMID:25280631 |
PMID:25281825 | PMID:25435015 | PMID:25450391 | PMID:25450970 | PMID:25522698 | PMID:25572400 | PMID:25643046 | PMID:25707991 | PMID:25853328 | PMID:25896910 | PMID:25922234 | PMID:25978088 |
PMID:25983001 | PMID:25998112 | PMID:26022925 | PMID:26061765 | PMID:26104335 | PMID:26107283 | PMID:26157118 | PMID:26159734 | PMID:26224839 | PMID:26268049 | PMID:26268531 | PMID:26323476 |
PMID:26368533 | PMID:26528810 | PMID:26667279 | PMID:26683373 | PMID:26710111 | PMID:26778001 | PMID:26836195 | PMID:26864450 | PMID:26871627 | PMID:26878132 | PMID:26946358 | PMID:27056979 |
PMID:27057694 | PMID:27107654 | PMID:27112151 | PMID:27184108 | PMID:27216988 | PMID:27310471 | PMID:27344333 | PMID:27535221 | PMID:27576687 | PMID:27606840 | PMID:27611644 | PMID:27639164 |
PMID:27793473 | PMID:27803163 | PMID:27803245 | PMID:27818203 | PMID:27910931 | PMID:27959938 | PMID:28004805 | PMID:28030950 | PMID:28102071 | PMID:28102851 | PMID:28205568 | PMID:28260678 |
PMID:28271922 | PMID:28298427 | PMID:28314738 | PMID:28341739 | PMID:28412969 | PMID:28415023 | PMID:28533442 | PMID:28650319 | PMID:28671123 | PMID:28692055 | PMID:28693923 | PMID:28759037 |
PMID:28795797 | PMID:28800967 | PMID:28838676 | PMID:28900035 | PMID:28901450 | PMID:28931606 | PMID:29107182 | PMID:29127190 | PMID:29141869 | PMID:29180619 | PMID:29382530 | PMID:29393338 |
PMID:29460268 | PMID:29478593 | PMID:29509190 | PMID:29569252 | PMID:29679649 | PMID:29791485 | PMID:30181558 | PMID:30336980 | PMID:30359282 | PMID:30401430 | PMID:30478887 | PMID:30569742 |
PMID:30600179 | PMID:30606247 | PMID:30654447 | PMID:30792490 | PMID:30826454 | PMID:30830863 | PMID:30922182 | PMID:30926338 | PMID:30938429 | PMID:31020572 | PMID:31020675 | PMID:31079927 |
PMID:31161647 | PMID:31189938 | PMID:31340582 | PMID:31477838 | PMID:31511544 | PMID:31547531 | PMID:31583788 | PMID:31651418 | PMID:31713950 | PMID:31844149 | PMID:31870551 | PMID:31931179 |
PMID:31980649 | PMID:31989677 | PMID:31991323 | PMID:32001774 | PMID:32098855 | PMID:32284600 | PMID:32321762 | PMID:32458274 | PMID:32502491 | PMID:32514176 | PMID:32560489 | PMID:32612191 |
PMID:32645484 | PMID:32683652 | PMID:32707033 | PMID:32728168 | PMID:32780723 | PMID:32814053 | PMID:32875355 | PMID:32889654 | PMID:32988885 | PMID:33092220 | PMID:33092231 | PMID:33454496 |
PMID:33477465 | PMID:33542378 | PMID:33618749 | PMID:33644029 | PMID:33767435 | PMID:33896033 | PMID:34064393 | PMID:34102212 | PMID:34246750 | PMID:34324063 | PMID:34487324 | PMID:34516876 |
PMID:34517052 | PMID:34656326 | PMID:34663460 | PMID:34696491 | PMID:34705895 | PMID:34782343 | PMID:34810220 | PMID:34831353 | PMID:34948096 | PMID:35000151 | PMID:35013218 | PMID:35176965 |
PMID:35387866 | PMID:35696571 | PMID:36037966 | PMID:36088465 | PMID:36138047 | PMID:36213323 | PMID:36215168 | PMID:36499498 | PMID:36543142 | PMID:36744645 | PMID:36843471 | PMID:36879070 |
PMID:36939723 | PMID:37132043 | PMID:37156880 | PMID:37499664 | PMID:37535656 | PMID:37669322 | PMID:37689591 | PMID:37819170 | PMID:37834279 | PMID:38065962 | PMID:38245532 | PMID:38347462 |
PMID:38474214 | PMID:39048735 | PMID:39095901 | PMID:39119937 | PMID:39147880 | PMID:39212313 | PMID:39238192 | PMID:39392708 | PMID:39499777 | PMID:39826709 |
PRNP (Homo sapiens - human) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Prnp (Mus musculus - house mouse) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Prnp (Rattus norvegicus - Norway rat) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Prnp (Chinchilla lanigera - long-tailed chinchilla) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP (Pan paniscus - bonobo/pygmy chimpanzee) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP (Canis lupus familiaris - dog) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Prnp (Ictidomys tridecemlineatus - thirteen-lined ground squirrel) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP (Sus scrofa - pig) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP (Chlorocebus sabaeus - green monkey) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Prnp (Heterocephalus glaber - naked mole-rat) |
|
.
Variants in PRNP
163 total Variants ![]() |
Name | Type | Condition(s) | Position(s) | Clinical significance |
PRNP, ASP178ASN AND MET129 | variation | Fatal familial insomnia [RCV000032588] | Chr20:20p13 | pathogenic |
NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter) | single nucleotide variant | CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074469] | Chr20:4699655 [GRCh38] Chr20:4680301 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.478C>T (p.Gln160Ter) | single nucleotide variant | CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074470]|Huntington disease-like 1 [RCV002513138] | Chr20:4699698 [GRCh38] Chr20:4680344 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.532G>A (p.Asp178Asn) | single nucleotide variant | Fatal familial insomnia [RCV000020248]|Gerstmann-Straussler-Scheinker syndrome [RCV005252115]|Huntington disease-like 1 [RCV001214652]|not provided [RCV001200144] | Chr20:4699752 [GRCh38] Chr20:4680398 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic|not provided |
NM_000311.5(PRNP):c.154_177[6_13] | microsatellite | Gerstmann-Straussler-Scheinker syndrome [RCV000014327]|Huntington disease-like 1 [RCV000014328]|Inherited Creutzfeldt-Jakob disease [RCV000014326]|Inherited prion disease [RCV000020259] | Chr20:4699379..4699380 [GRCh38] Chr20:4680026..4680049 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.305C>T (p.Pro102Leu) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014329]|Huntington disease-like 1 [RCV001203438]|Inherited Creutzfeldt-Jakob disease [RCV001813741]|Spongiform encephalopathy with neuropsychiatric features [RCV001642224]|not provided [RCV001269667] | Chr20:4699525 [GRCh38] Chr20:4680171 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.350C>T (p.Ala117Val) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014330]|Inborn genetic diseases [RCV000623716]|not provided [RCV005089252] | Chr20:4699570 [GRCh38] Chr20:4680216 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.385A>G (p.Met129Val) | single nucleotide variant | Alzheimer disease, early-onset, susceptibility to [RCV000014332]|Aphasia, primary progressive, susceptibility to [RCV000014333]|Autism spectrum disorder [RCV003313921]|Fatal familial insomnia [RCV003450639]|Huntington disease-like 1 [RCV000990275]|Inherited Creutzfeldt-Jakob disease [RCV001262968]|Inherited Creutzfeldt-Jakob disease [RCV002490365]|Inherited prion disease [RCV000020244]|Prion disease, susceptibility to [RCV000014331]|not provided [RCV001723566]|not specified [RCV000118064] | Chr20:4699605 [GRCh38] Chr20:4680251 [GRCh37] Chr20:20p13 |
risk factor|likely risk allele|benign|likely benign|uncertain significance |
NM_000311.5(PRNP):c.598G>A (p.Glu200Lys) | single nucleotide variant | Fatal familial insomnia [RCV000014335]|Huntington disease-like 1 [RCV000644587]|Inherited Creutzfeldt-Jakob disease [RCV000014334]|Inherited Creutzfeldt-Jakob disease [RCV005025054]|not provided [RCV001310451] | Chr20:4699818 [GRCh38] Chr20:4680464 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.593T>C (p.Phe198Ser) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014340]|Huntington disease-like 1 [RCV000644586]|not provided [RCV001551488] | Chr20:4699813 [GRCh38] Chr20:4680459 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.650A>G (p.Gln217Arg) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014341]|Huntington disease-like 1 [RCV001851852]|PRNP-related disorder [RCV003987321] | Chr20:4699870 [GRCh38] Chr20:4680516 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic |
NM_000311.5(PRNP):c.628G>A (p.Val210Ile) | single nucleotide variant | Huntington disease-like 1 [RCV000532969]|Inborn genetic diseases [RCV004018625]|Inherited Creutzfeldt-Jakob disease [RCV000014342]|Inherited Creutzfeldt-Jakob disease [RCV002476962] | Chr20:4699848 [GRCh38] Chr20:4680494 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic|low penetrance |
NM_000311.5(PRNP):c.314C>T (p.Pro105Leu) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014343]|Inborn genetic diseases [RCV000190750] | Chr20:4699534 [GRCh38] Chr20:4680180 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.538G>A (p.Val180Ile) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV001807726]|Huntington disease-like 1 [RCV001212635]|Inherited Creutzfeldt-Jakob disease [RCV000014344]|Inherited Creutzfeldt-Jakob disease [RCV002476963]|Inherited prion disease [RCV000020249] | Chr20:4699758 [GRCh38] Chr20:4680404 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|low penetrance |
NM_000311.5(PRNP):c.695T>G (p.Met232Arg) | single nucleotide variant | Huntington disease-like 1 [RCV000990277]|Inherited Creutzfeldt-Jakob disease [RCV000014345]|Inherited Creutzfeldt-Jakob disease [RCV002496357] | Chr20:4699915 [GRCh38] Chr20:4680561 [GRCh37] Chr20:20p13 |
pathogenic|uncertain significance |
NM_000311.5(PRNP):c.547A>G (p.Thr183Ala) | single nucleotide variant | Huntington disease-like 1 [RCV003514300]|Spongiform encephalopathy with neuropsychiatric features [RCV000014347] | Chr20:4699767 [GRCh38] Chr20:4680413 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.512A>G (p.Asn171Ser) | single nucleotide variant | Huntington disease-like 1 [RCV000644585]|Inherited prion disease [RCV000020247]|Spongiform encephalopathy with neuropsychiatric features [RCV000014348]|not provided [RCV001580052]|not specified [RCV001725931] | Chr20:4699732 [GRCh38] Chr20:4680378 [GRCh37] Chr20:20p13 |
benign|likely benign|uncertain significance |
NM_000311.5(PRNP):c.655G>A (p.Glu219Lys) | single nucleotide variant | Huntington disease-like 1 [RCV000873683]|Inherited prion disease [RCV000020257]|Reclassified - variant of unknown significance [RCV004577713]|not provided [RCV001573203] | Chr20:4699875 [GRCh38] Chr20:4680521 [GRCh37] Chr20:20p13 |
benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance |
NM_000311.5(PRNP):c.392G>T (p.Gly131Val) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014351]|Huntington disease-like 1 [RCV001348311] | Chr20:4699612 [GRCh38] Chr20:4680258 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic|uncertain significance |
NM_000311.5(PRNP):c.623G>A (p.Arg208His) | single nucleotide variant | Huntington disease-like 1 [RCV001851853]|Inherited Creutzfeldt-Jakob disease [RCV000014352]|PRNP-related disorder [RCV002468968]|not provided [RCV001823096] | Chr20:4699843 [GRCh38] Chr20:4680489 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic|uncertain significance |
NM_000311.5(PRNP):c.560A>G (p.His187Arg) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014353]|Spongiform encephalopathy with neuropsychiatric features [RCV000014354] | Chr20:4699780 [GRCh38] Chr20:4680426 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.313C>A (p.Pro105Thr) | single nucleotide variant | Spongiform encephalopathy with neuropsychiatric features [RCV000014355] | Chr20:4699533 [GRCh38] Chr20:4680179 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.398C>T (p.Ala133Val) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014356] | Chr20:4699618 [GRCh38] Chr20:4680264 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.313C>T (p.Pro105Ser) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000014357]|not provided [RCV003319302] | Chr20:4699533 [GRCh38] Chr20:4680179 [GRCh37] Chr20:20p13 |
pathogenic|uncertain significance |
NM_000311.5(PRNP):c.380G>T (p.Gly127Val) | single nucleotide variant | Kuru, protection against [RCV000014358] | Chr20:4699600 [GRCh38] Chr20:4680246 [GRCh37] Chr20:20p13 |
protective |
NM_000311.5(PRNP):c.180T>C (p.Pro60=) | single nucleotide variant | Spongiform encephalopathy with neuropsychiatric features [RCV000549562] | Chr20:4699400 [GRCh38] Chr20:4680046 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del) | microsatellite | Huntington disease-like 1 [RCV000644588]|Inherited Creutzfeldt-Jakob disease [RCV002490633]|Inherited prion disease [RCV000055681]|not provided [RCV001560143] | Chr20:4699380..4699403 [GRCh38] Chr20:4680026..4680049 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.631G>C (p.Glu211Gln) | single nucleotide variant | Inherited Creutzfeldt-Jakob disease [RCV000074468] | Chr20:4699851 [GRCh38] Chr20:4680497 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.679C>T (p.Gln227Ter) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000074472] | Chr20:4699899 [GRCh38] Chr20:4680545 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.489C>G (p.Tyr163Ter) | single nucleotide variant | CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074473] | Chr20:4699709 [GRCh38] Chr20:4680355 [GRCh37] Chr20:20p13 |
pathogenic |
GRCh38/hg38 20p13-11.21(chr20:89939-25697564)x3 | copy number gain | See cases [RCV000051227] | Chr20:89939..25697564 [GRCh38] Chr20:70580..25678200 [GRCh37] Chr20:18580..25626200 [NCBI36] Chr20:20p13-11.21 |
pathogenic |
GRCh38/hg38 20p13-11.23(chr20:89939-19146279)x3 | copy number gain | See cases [RCV000051041] | Chr20:89939..19146279 [GRCh38] Chr20:70580..19126923 [GRCh37] Chr20:18580..19074923 [NCBI36] Chr20:20p13-11.23 |
pathogenic |
GRCh38/hg38 20p13-11.23(chr20:89939-19071495)x3 | copy number gain | See cases [RCV000052995] | Chr20:89939..19071495 [GRCh38] Chr20:70580..19052139 [GRCh37] Chr20:18580..19000139 [NCBI36] Chr20:20p13-11.23 |
pathogenic |
GRCh38/hg38 20p13-11.22(chr20:89939-21787252)x3 | copy number gain | Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052996]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052996]|See cases [RCV000052996] | Chr20:89939..21787252 [GRCh38] Chr20:70580..21767890 [GRCh37] Chr20:18580..21715890 [NCBI36] Chr20:20p13-11.22 |
pathogenic |
GRCh38/hg38 20p13-12.1(chr20:89939-14818511)x3 | copy number gain | Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052997]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052997]|See cases [RCV000052997] | Chr20:89939..14818511 [GRCh38] Chr20:70580..14799157 [GRCh37] Chr20:18580..14747157 [NCBI36] Chr20:20p13-12.1 |
pathogenic |
NM_000311.5(PRNP):c.633G>C (p.Glu211Asp) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV000074467]|Huntington disease-like 1 [RCV001854271] | Chr20:4699853 [GRCh38] Chr20:4680499 [GRCh37] Chr20:20p13 |
pathogenic|uncertain significance |
NM_000311.5(PRNP):c.678C>A (p.Tyr226Ter) | single nucleotide variant | CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074471]|not provided [RCV002054924] | Chr20:4699898 [GRCh38] Chr20:4680544 [GRCh37] Chr20:20p13 |
pathogenic|likely pathogenic |
GRCh38/hg38 20p13-q11.1(chr20:80106-30227427)x3 | copy number gain | See cases [RCV000133996] | Chr20:80106..30227427 [GRCh38] Chr20:60747..29462103 [GRCh37] Chr20:8747..28075764 [NCBI36] Chr20:20p13-q11.1 |
pathogenic |
GRCh38/hg38 20p13-q13.33(chr20:99557-64277321)x3 | copy number gain | See cases [RCV000135859] | Chr20:99557..64277321 [GRCh38] Chr20:80198..62908674 [GRCh37] Chr20:28198..62379118 [NCBI36] Chr20:20p13-q13.33 |
pathogenic |
GRCh38/hg38 20p13(chr20:4594991-5050271)x3 | copy number gain | See cases [RCV000135607] | Chr20:4594991..5050271 [GRCh38] Chr20:4575637..5030917 [GRCh37] Chr20:4523637..4978917 [NCBI36] Chr20:20p13 |
uncertain significance |
GRCh38/hg38 20p13-12.3(chr20:4343033-6911730)x1 | copy number loss | See cases [RCV000137695] | Chr20:4343033..6911730 [GRCh38] Chr20:4323680..6892377 [GRCh37] Chr20:4271680..6840377 [NCBI36] Chr20:20p13-12.3 |
pathogenic |
NM_000311.5(PRNP):c.228C>T (p.Pro76=) | single nucleotide variant | Huntington disease-like 1 [RCV000644590]|Inherited prion disease [RCV000283524]|not provided [RCV004703470]|not specified [RCV000202898] | Chr20:4699448 [GRCh38] Chr20:4680094 [GRCh37] Chr20:20p13 |
benign|likely benign |
GRCh38/hg38 20p13-12.1(chr20:80106-13029401)x3 | copy number gain | See cases [RCV000138677] | Chr20:80106..13029401 [GRCh38] Chr20:60747..13010049 [GRCh37] Chr20:8747..12958049 [NCBI36] Chr20:20p13-12.1 |
pathogenic |
GRCh38/hg38 20p13-12.3(chr20:80093-6386012)x3 | copy number gain | See cases [RCV000139597] | Chr20:80093..6386012 [GRCh38] Chr20:60734..6366659 [GRCh37] Chr20:8734..6314659 [NCBI36] Chr20:20p13-12.3 |
pathogenic |
GRCh38/hg38 20p13-12.3(chr20:84402-6159078)x3 | copy number gain | See cases [RCV000141348] | Chr20:84402..6159078 [GRCh38] Chr20:65043..6139725 [GRCh37] Chr20:13043..6087725 [NCBI36] Chr20:20p13-12.3 |
pathogenic |
GRCh38/hg38 20p13-11.1(chr20:80927-26324843)x3 | copy number gain | See cases [RCV000142017] | Chr20:80927..26324843 [GRCh38] Chr20:61568..26305479 [GRCh37] Chr20:9568..26253479 [NCBI36] Chr20:20p13-11.1 |
pathogenic |
GRCh38/hg38 20p13-12.3(chr20:80927-5447679)x3 | copy number gain | See cases [RCV000142285] | Chr20:80927..5447679 [GRCh38] Chr20:61568..5428325 [GRCh37] Chr20:9568..5376325 [NCBI36] Chr20:20p13-12.3 |
uncertain significance |
GRCh38/hg38 20p13-12.3(chr20:1269303-8626911)x3 | copy number gain | See cases [RCV000142917] | Chr20:1269303..8626911 [GRCh38] Chr20:1249947..8607558 [GRCh37] Chr20:1197947..8555558 [NCBI36] Chr20:20p13-12.3 |
pathogenic |
GRCh38/hg38 20p13-11.23(chr20:80928-18688031)x3 | copy number gain | See cases [RCV000143426] | Chr20:80928..18688031 [GRCh38] Chr20:61569..18668675 [GRCh37] Chr20:9569..18616675 [NCBI36] Chr20:20p13-11.23 |
pathogenic |
NM_000311.5(PRNP):c.635A>C (p.Gln212Pro) | single nucleotide variant | Fatal familial insomnia [RCV001786518]|Gerstmann-Straussler-Scheinker syndrome [RCV003994328]|Huntington disease-like 1 [RCV002034620] | Chr20:4699855 [GRCh38] Chr20:4680501 [GRCh37] Chr20:20p13 |
likely pathogenic|uncertain significance |
GRCh37/hg19 20p13-12.3(chr20:121521-5564937)x3 | copy number gain | See cases [RCV000239772] | Chr20:121521..5564937 [GRCh37] Chr20:20p13-12.3 |
pathogenic |
GRCh37/hg19 20p13-11.1(chr20:80198-26075841)x3 | copy number gain | See cases [RCV000239954] | Chr20:80198..26075841 [GRCh37] Chr20:20p13-11.1 |
pathogenic |
NM_000311.5(PRNP):c.*1412T>A | single nucleotide variant | Inherited prion disease [RCV000308027] | Chr20:4701394 [GRCh38] Chr20:4682040 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.4(PRNP):c.-310T>A | single nucleotide variant | Inherited prion disease [RCV000354483] | Chr20:4686213 [GRCh38] Chr20:4666859 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*216G>A | single nucleotide variant | Inherited prion disease [RCV000272162] | Chr20:4700198 [GRCh38] Chr20:4680844 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*4A>T | single nucleotide variant | Inherited prion disease [RCV000313042]|not provided [RCV001653637] | Chr20:4699986 [GRCh38] Chr20:4680632 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*206A>G | single nucleotide variant | Inherited prion disease [RCV000364388]|not provided [RCV001653638] | Chr20:4700188 [GRCh38] Chr20:4680834 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*697A>G | single nucleotide variant | Inherited prion disease [RCV000279025]|not provided [RCV004718533] | Chr20:4700679 [GRCh38] Chr20:4681325 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*70G>A | single nucleotide variant | Inherited prion disease [RCV000369995]|not provided [RCV001584043] | Chr20:4700052 [GRCh38] Chr20:4680698 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*1588C>T | single nucleotide variant | Inherited prion disease [RCV000272914] | Chr20:4701570 [GRCh38] Chr20:4682216 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*936C>T | single nucleotide variant | Inherited prion disease [RCV000282495] | Chr20:4700918 [GRCh38] Chr20:4681564 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*672C>G | single nucleotide variant | Inherited prion disease [RCV000322658] | Chr20:4700654 [GRCh38] Chr20:4681300 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*592T>C | single nucleotide variant | Inherited prion disease [RCV000283945] | Chr20:4700574 [GRCh38] Chr20:4681220 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*115G>A | single nucleotide variant | Inherited Creutzfeldt-Jakob disease [RCV002487496]|Inherited prion disease [RCV000325989]|not provided [RCV004694609] | Chr20:4700097 [GRCh38] Chr20:4680743 [GRCh37] Chr20:20p13 |
likely benign|uncertain significance |
NM_000311.5(PRNP):c.-22C>G | single nucleotide variant | Inherited prion disease [RCV000274590] | Chr20:4686501 [GRCh38] Chr20:4667147 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.351A>G (p.Ala117=) | single nucleotide variant | Huntington disease-like 1 [RCV000539354]|Inherited prion disease [RCV000287089]|not provided [RCV001712126]|not specified [RCV001579381] | Chr20:4699571 [GRCh38] Chr20:4680217 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.160G>A (p.Gly54Ser) | single nucleotide variant | Huntington disease-like 1 [RCV000527040]|Inherited prion disease [RCV000326386]|not provided [RCV004597783] | Chr20:4699380 [GRCh38] Chr20:4680026 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*682A>G | single nucleotide variant | Inherited prion disease [RCV000379630]|not provided [RCV001709609] | Chr20:4700664 [GRCh38] Chr20:4681310 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.159C>T (p.Gly53=) | single nucleotide variant | Huntington disease-like 1 [RCV000958397]|Inherited Creutzfeldt-Jakob disease [RCV002504142]|Inherited prion disease [RCV000287805]|not provided [RCV004703828] | Chr20:4699379 [GRCh38] Chr20:4680025 [GRCh37] Chr20:20p13 |
benign|likely benign|uncertain significance |
NM_000311.5(PRNP):c.204T>C (p.Pro68=) | single nucleotide variant | Huntington disease-like 1 [RCV000874283]|Inherited prion disease [RCV000383267]|not provided [RCV001580001] | Chr20:4699424 [GRCh38] Chr20:4680070 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*800C>T | single nucleotide variant | Inherited prion disease [RCV000336389] | Chr20:4700782 [GRCh38] Chr20:4681428 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.372C>G (p.Gly124=) | single nucleotide variant | Huntington disease-like 1 [RCV000873874]|Inherited prion disease [RCV000334919]|not provided [RCV001580108] | Chr20:4699592 [GRCh38] Chr20:4680238 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.246A>G (p.Gly82=) | single nucleotide variant | Huntington disease-like 1 [RCV000644591]|Inherited prion disease [RCV000340924]|not provided [RCV004717391] | Chr20:4699466 [GRCh38] Chr20:4680112 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.*1281A>G | single nucleotide variant | Inherited prion disease [RCV000396883] | Chr20:4701263 [GRCh38] Chr20:4681909 [GRCh37] Chr20:20p13 |
likely benign|uncertain significance |
NM_000311.5(PRNP):c.*98TCT[1] | microsatellite | Inherited prion disease [RCV000277802] | Chr20:4700079..4700081 [GRCh38] Chr20:4680725..4680727 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.*1063G>A | single nucleotide variant | Inherited prion disease [RCV000314101] | Chr20:4701045 [GRCh38] Chr20:4681691 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.4(PRNP):c.-245C>G | single nucleotide variant | Inherited prion disease [RCV000262092]|not provided [RCV004717390] | Chr20:4686278 [GRCh38] Chr20:4666924 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.252T>C (p.Pro84=) | single nucleotide variant | Inherited prion disease [RCV000398037]|not provided [RCV004717392] | Chr20:4699472 [GRCh38] Chr20:4680118 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.424G>A (p.Gly142Ser) | single nucleotide variant | Huntington disease-like 1 [RCV000990276]|Inherited prion disease [RCV000299881]|not provided [RCV003736731] | Chr20:4699644 [GRCh38] Chr20:4680290 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.*874C>T | single nucleotide variant | Inherited prion disease [RCV000402484] | Chr20:4700856 [GRCh38] Chr20:4681502 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.-18C>T | single nucleotide variant | Inherited prion disease [RCV000388958] | Chr20:4686505 [GRCh38] Chr20:4667151 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.78G>A (p.Pro26=) | single nucleotide variant | not provided [RCV003312534] | Chr20:4699298 [GRCh38] Chr20:4679944 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.*358C>A | single nucleotide variant | Inherited prion disease [RCV000329503] | Chr20:4700340 [GRCh38] Chr20:4680986 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.-21G>T | single nucleotide variant | Inherited prion disease [RCV000332043] | Chr20:4686502 [GRCh38] Chr20:4667148 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*1466G>C | single nucleotide variant | Inherited prion disease [RCV000365069] | Chr20:4701448 [GRCh38] Chr20:4682094 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*994C>T | single nucleotide variant | Inherited prion disease [RCV000349067] | Chr20:4700976 [GRCh38] Chr20:4681622 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.4(PRNP):c.-206C>G | single nucleotide variant | Inherited prion disease [RCV000366752] | Chr20:4686317 [GRCh38] Chr20:4666963 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.4(PRNP):c.-211G>A | single nucleotide variant | Inherited prion disease [RCV000319119] | Chr20:4686312 [GRCh38] Chr20:4666958 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*1193G>A | single nucleotide variant | Inherited prion disease [RCV000352526] | Chr20:4701175 [GRCh38] Chr20:4681821 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*407T>G | single nucleotide variant | Inherited prion disease [RCV000376080] | Chr20:4700389 [GRCh38] Chr20:4681035 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*1035T>G | single nucleotide variant | Inherited prion disease [RCV000396906] | Chr20:4701017 [GRCh38] Chr20:4681663 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.497T>C (p.Met166Thr) | single nucleotide variant | Inherited prion disease [RCV001139175] | Chr20:4699717 [GRCh38] Chr20:4680363 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.415A>G (p.Ile139Val) | single nucleotide variant | not provided [RCV000522930] | Chr20:4699635 [GRCh38] Chr20:4680281 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13(chr20:61568-4914872)x3 | copy number gain | See cases [RCV000446883] | Chr20:61568..4914872 [GRCh37] Chr20:20p13 |
pathogenic |
GRCh37/hg19 20p13-12.1(chr20:4392930-12667768)x1 | copy number loss | See cases [RCV000446718] | Chr20:4392930..12667768 [GRCh37] Chr20:20p13-12.1 |
pathogenic |
GRCh37/hg19 20p13(chr20:61568-4904599)x3 | copy number gain | See cases [RCV000448397] | Chr20:61568..4904599 [GRCh37] Chr20:20p13 |
pathogenic |
GRCh37/hg19 20p13-q11.21(chr20:80198-26208081)x3 | copy number gain | not provided [RCV000487461] | Chr20:80198..26208081 [GRCh37] Chr20:20p13-q11.21 |
pathogenic |
GRCh37/hg19 20p13-12.3(chr20:213423-5483406)x3 | copy number gain | See cases [RCV000510531] | Chr20:213423..5483406 [GRCh37] Chr20:20p13-12.3 |
uncertain significance |
GRCh37/hg19 20p13-12.3(chr20:2463101-8185680)x1 | copy number loss | See cases [RCV000511897] | Chr20:2463101..8185680 [GRCh37] Chr20:20p13-12.3 |
pathogenic |
GRCh37/hg19 20p13-q13.33(chr20:61569-62915555)x3 | copy number gain | See cases [RCV000510832] | Chr20:61569..62915555 [GRCh37] Chr20:20p13-q13.33 |
pathogenic |
NM_000311.5(PRNP):c.246_269del (p.60_67PHGGGWGQ[3]) | deletion | Huntington disease-like 1 [RCV000990274]|not provided [RCV001706695] | Chr20:4699449..4699472 [GRCh38] Chr20:4680095..4680118 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.198G>A (p.Gly66=) | single nucleotide variant | Spongiform encephalopathy with neuropsychiatric features [RCV000536485] | Chr20:4699418 [GRCh38] Chr20:4680064 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13-q13.33(chr20:61569-62915555) | copy number gain | See cases [RCV000512450] | Chr20:61569..62915555 [GRCh37] Chr20:20p13-q13.33 |
pathogenic |
GRCh37/hg19 20p13-12.2(chr20:61568-10486106)x3 | copy number gain | See cases [RCV000512556] | Chr20:61568..10486106 [GRCh37] Chr20:20p13-12.2 |
likely pathogenic |
GRCh37/hg19 20p13-12.1(chr20:3092739-17091453)x1 | copy number loss | not provided [RCV000684134] | Chr20:3092739..17091453 [GRCh37] Chr20:20p13-12.1 |
pathogenic |
NM_000311.5(PRNP):c.462G>A (p.Met154Ile) | single nucleotide variant | Huntington disease-like 1 [RCV000690098] | Chr20:4699682 [GRCh38] Chr20:4680328 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13-q13.33(chr20:63244-62948788)x3 | copy number gain | not provided [RCV000741058] | Chr20:63244..62948788 [GRCh37] Chr20:20p13-q13.33 |
pathogenic |
GRCh37/hg19 20p13-q13.33(chr20:63244-62961294)x3 | copy number gain | not provided [RCV000741059] | Chr20:63244..62961294 [GRCh37] Chr20:20p13-q13.33 |
pathogenic |
GRCh37/hg19 20p13-q13.33(chr20:63244-62912463)x3 | copy number gain | not provided [RCV000741057] | Chr20:63244..62912463 [GRCh37] Chr20:20p13-q13.33 |
pathogenic |
NM_000311.5(PRNP):c.306G>A (p.Pro102=) | single nucleotide variant | Huntington disease-like 1 [RCV000945465]|Inherited Creutzfeldt-Jakob disease [RCV002489280]|not provided [RCV001811543] | Chr20:4699526 [GRCh38] Chr20:4680172 [GRCh37] Chr20:20p13 |
benign|likely benign |
NM_000311.5(PRNP):c.366G>T (p.Val122=) | single nucleotide variant | Huntington disease-like 1 [RCV002542239] | Chr20:4699586 [GRCh38] Chr20:4680232 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.624C>T (p.Arg208=) | single nucleotide variant | Huntington disease-like 1 [RCV002064803] | Chr20:4699844 [GRCh38] Chr20:4680490 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.700C>T (p.Leu234Phe) | single nucleotide variant | Huntington disease-like 1 [RCV002539998] | Chr20:4699920 [GRCh38] Chr20:4680566 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.50G>C (p.Ser17Thr) | single nucleotide variant | Huntington disease-like 1 [RCV003626668]|not provided [RCV001091285] | Chr20:4699270 [GRCh38] Chr20:4679916 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) | microsatellite | PRNP-associated condition [RCV000850408] | Chr20:4699379..4699380 [GRCh38] Chr20:4680025..4680026 [GRCh37] Chr20:20p13 |
pathogenic |
NC_000020.11:g.4701861C>T | single nucleotide variant | not provided [RCV001620377] | Chr20:4701861 [GRCh38] Chr20:4682507 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.519C>T (p.Asn173=) | single nucleotide variant | Huntington disease-like 1 [RCV000945928] | Chr20:4699739 [GRCh38] Chr20:4680385 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.565G>A (p.Val189Ile) | single nucleotide variant | Inherited prion disease [RCV001139176]|not provided [RCV004720768]|not specified [RCV003117783] | Chr20:4699785 [GRCh38] Chr20:4680431 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.5C>T (p.Ala2Val) | single nucleotide variant | Huntington disease-like 1 [RCV001858941]|Inherited prion disease [RCV001143500] | Chr20:4699225 [GRCh38] Chr20:4679871 [GRCh37] Chr20:20p13 |
likely benign|uncertain significance |
NM_000311.5(PRNP):c.661G>A (p.Glu221Lys) | single nucleotide variant | not provided [RCV003231659] | Chr20:4699881 [GRCh38] Chr20:4680527 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13-11.1(chr20:61568-26305479)x3 | copy number gain | not provided [RCV001007068] | Chr20:61568..26305479 [GRCh37] Chr20:20p13-11.1 |
pathogenic |
NM_000311.5(PRNP):c.325A>T (p.Met109Leu) | single nucleotide variant | Huntington disease-like 1 [RCV005105144]|not provided [RCV004801556] | Chr20:4699545 [GRCh38] Chr20:4680191 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.-10-21G>A | single nucleotide variant | not provided [RCV001639102] | Chr20:4699190 [GRCh38] Chr20:4679836 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.*460G>T | single nucleotide variant | Inherited prion disease [RCV001141798] | Chr20:4700442 [GRCh38] Chr20:4681088 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.116C>T (p.Pro39Leu) | single nucleotide variant | Huntington disease-like 1 [RCV001361599]|Inherited prion disease [RCV001143502] | Chr20:4699336 [GRCh38] Chr20:4679982 [GRCh37] Chr20:20p13 |
benign|uncertain significance |
GRCh37/hg19 20p13(chr20:4439086-4676435)x3 | copy number gain | not provided [RCV001007075] | Chr20:4439086..4676435 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.76C>G (p.Pro26Ala) | single nucleotide variant | Inherited prion disease [RCV001143501] | Chr20:4699296 [GRCh38] Chr20:4679942 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*482A>G | single nucleotide variant | Inherited prion disease [RCV001143601] | Chr20:4700464 [GRCh38] Chr20:4681110 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.654C>T (p.Tyr218=) | single nucleotide variant | Huntington disease-like 1 [RCV002070645]|Inherited prion disease [RCV001139177]|not provided [RCV003433025] | Chr20:4699874 [GRCh38] Chr20:4680520 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.606C>T (p.Asp202=) | single nucleotide variant | Huntington disease-like 1 [RCV002069605]|not provided [RCV001091286] | Chr20:4699826 [GRCh38] Chr20:4680472 [GRCh37] Chr20:20p13 |
likely benign|uncertain significance |
NM_000311.5(PRNP):c.*1134T>A | single nucleotide variant | Inherited prion disease [RCV001137030] | Chr20:4701116 [GRCh38] Chr20:4681762 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.*1328T>C | single nucleotide variant | Inherited prion disease [RCV001137031] | Chr20:4701310 [GRCh38] Chr20:4681956 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.180_227del (p.60_67PHGGGWGQ[2]) | deletion | Huntington disease-like 1 [RCV001064781] | Chr20:4699380..4699427 [GRCh38] Chr20:4680026..4680073 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.143G>A (p.Arg48His) | single nucleotide variant | Huntington disease-like 1 [RCV005093605]|Inherited prion disease [RCV001136928]|not provided [RCV001811670] | Chr20:4699363 [GRCh38] Chr20:4680009 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13(chr20:3092739-4939933)x3 | copy number gain | not provided [RCV001258903] | Chr20:3092739..4939933 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.290G>A (p.Ser97Asn) | single nucleotide variant | Huntington disease-like 1 [RCV001302191]|not specified [RCV002246290] | Chr20:4699510 [GRCh38] Chr20:4680156 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.414C>G (p.Ile138Met) | single nucleotide variant | not specified [RCV002248131] | Chr20:4699634 [GRCh38] Chr20:4680280 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.467G>A (p.Arg156His) | single nucleotide variant | not provided [RCV001768366] | Chr20:4699687 [GRCh38] Chr20:4680333 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.483G>A (p.Val161=) | single nucleotide variant | not provided [RCV001816303] | Chr20:4699703 [GRCh38] Chr20:4680349 [GRCh37] Chr20:20p13 |
likely benign |
GRCh37/hg19 20p13-12.2(chr20:3178539-11848383) | copy number loss | 20p12.3 microdeletion syndrome [RCV002280726] | Chr20:3178539..11848383 [GRCh37] Chr20:20p13-12.2 |
pathogenic |
NM_000311.5(PRNP):c.392G>A (p.Gly131Glu) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV001809309] | Chr20:4699612 [GRCh38] Chr20:4680258 [GRCh37] Chr20:20p13 |
likely pathogenic |
NM_000311.5(PRNP):c.452G>T (p.Arg151Leu) | single nucleotide variant | Huntington disease-like 1 [RCV001915256]|Inborn genetic diseases [RCV004955766]|not provided [RCV003130585] | Chr20:4699672 [GRCh38] Chr20:4680318 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.408G>T (p.Arg136Ser) | single nucleotide variant | Huntington disease-like 1 [RCV002025659] | Chr20:4699628 [GRCh38] Chr20:4680274 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.625G>A (p.Val209Met) | single nucleotide variant | Huntington disease-like 1 [RCV001913502] | Chr20:4699845 [GRCh38] Chr20:4680491 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.498G>A (p.Met166Ile) | single nucleotide variant | Huntington disease-like 1 [RCV001968814]|Inherited Creutzfeldt-Jakob disease [RCV002479611] | Chr20:4699718 [GRCh38] Chr20:4680364 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.620A>G (p.Glu207Gly) | single nucleotide variant | Huntington disease-like 1 [RCV001945632] | Chr20:4699840 [GRCh38] Chr20:4680486 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.713C>T (p.Pro238Leu) | single nucleotide variant | Vascular dementia [RCV002051771] | Chr20:4699933 [GRCh38] Chr20:4680579 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.86G>A (p.Gly29Glu) | single nucleotide variant | Huntington disease-like 1 [RCV001991499] | Chr20:4699306 [GRCh38] Chr20:4679952 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.622C>T (p.Arg208Cys) | single nucleotide variant | Huntington disease-like 1 [RCV001916110] | Chr20:4699842 [GRCh38] Chr20:4680488 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.755T>C (p.Val252Ala) | single nucleotide variant | Huntington disease-like 1 [RCV001973743] | Chr20:4699975 [GRCh38] Chr20:4680621 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.493C>T (p.Pro165Ser) | single nucleotide variant | Huntington disease-like 1 [RCV002019709] | Chr20:4699713 [GRCh38] Chr20:4680359 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.407G>C (p.Arg136Thr) | single nucleotide variant | Huntington disease-like 1 [RCV002014156] | Chr20:4699627 [GRCh38] Chr20:4680273 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.443G>A (p.Arg148His) | single nucleotide variant | Huntington disease-like 1 [RCV002009625]|Inherited Creutzfeldt-Jakob disease [RCV003324843] | Chr20:4699663 [GRCh38] Chr20:4680309 [GRCh37] Chr20:20p13 |
likely pathogenic |
NM_000311.5(PRNP):c.222_245del (p.60PHGGGWGQ[3]) | deletion | Huntington disease-like 1 [RCV002019177]|not specified [RCV003388076] | Chr20:4699425..4699448 [GRCh38] Chr20:4680071..4680094 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.384_385inv (p.Met129Val) | inversion | Huntington disease-like 1 [RCV002204940] | Chr20:4699604..4699605 [GRCh38] Chr20:4680250..4680251 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.603C>T (p.Thr201=) | single nucleotide variant | Huntington disease-like 1 [RCV002092386] | Chr20:4699823 [GRCh38] Chr20:4680469 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.117G>A (p.Pro39=) | single nucleotide variant | Huntington disease-like 1 [RCV002187888] | Chr20:4699337 [GRCh38] Chr20:4679983 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.507C>T (p.Tyr169=) | single nucleotide variant | Huntington disease-like 1 [RCV002085366] | Chr20:4699727 [GRCh38] Chr20:4680373 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.531C>T (p.His177=) | single nucleotide variant | Huntington disease-like 1 [RCV002215323]|Inborn genetic diseases [RCV003375573] | Chr20:4699751 [GRCh38] Chr20:4680397 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.408G>A (p.Arg136=) | single nucleotide variant | Huntington disease-like 1 [RCV002105659] | Chr20:4699628 [GRCh38] Chr20:4680274 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.636G>A (p.Gln212=) | single nucleotide variant | Huntington disease-like 1 [RCV002078334]|Inherited Creutzfeldt-Jakob disease [RCV002498286] | Chr20:4699856 [GRCh38] Chr20:4680502 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.228_251del (p.60PHGGGWGQ[3]) | deletion | Huntington disease-like 1 [RCV002076280]|not provided [RCV003883778] | Chr20:4699443..4699466 [GRCh38] Chr20:4680089..4680112 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.225G>A (p.Gln75=) | single nucleotide variant | Huntington disease-like 1 [RCV002139675]|not provided [RCV004704760] | Chr20:4699445 [GRCh38] Chr20:4680091 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.591C>T (p.Asn197=) | single nucleotide variant | Huntington disease-like 1 [RCV002219413] | Chr20:4699811 [GRCh38] Chr20:4680457 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.333C>T (p.His111=) | single nucleotide variant | Huntington disease-like 1 [RCV002162411] | Chr20:4699553 [GRCh38] Chr20:4680199 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.537C>T (p.Cys179=) | single nucleotide variant | Huntington disease-like 1 [RCV002219087] | Chr20:4699757 [GRCh38] Chr20:4680403 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.57G>A (p.Leu19=) | single nucleotide variant | Huntington disease-like 1 [RCV002137583] | Chr20:4699277 [GRCh38] Chr20:4679923 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.714_716del (p.Pro239del) | deletion | not specified [RCV002222914] | Chr20:4699932..4699934 [GRCh38] Chr20:4680578..4680580 [GRCh37] Chr20:20p13 |
uncertain significance |
NC_000020.10:g.(?_1959939)_(6760201_?)dup | duplication | Huntington disease-like 1 [RCV003110989]|Pigmentary pallidal degeneration [RCV003122285] | Chr20:1959939..6760201 [GRCh37] Chr20:20p13-12.3 |
uncertain significance |
NM_000311.5(PRNP):c.546C>G (p.Ile182Met) | single nucleotide variant | Huntington disease-like 1 [RCV003115276] | Chr20:4699766 [GRCh38] Chr20:4680412 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.284C>A (p.Thr95Asn) | single nucleotide variant | not provided [RCV004776811] | Chr20:4699504 [GRCh38] Chr20:4680150 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.696G>T (p.Met232Ile) | single nucleotide variant | not provided [RCV002287003] | Chr20:4699916 [GRCh38] Chr20:4680562 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.473C>T (p.Pro158Leu) | single nucleotide variant | not provided [RCV002283037] | Chr20:4699693 [GRCh38] Chr20:4680339 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.206A>T (p.His69Leu) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV002283861] | Chr20:4699426 [GRCh38] Chr20:4680072 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.278G>A (p.Gly93Asp) | single nucleotide variant | Huntington disease-like 1 [RCV002302379] | Chr20:4699498 [GRCh38] Chr20:4680144 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.6G>A (p.Ala2=) | single nucleotide variant | Huntington disease-like 1 [RCV002816171] | Chr20:4699226 [GRCh38] Chr20:4679872 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.452G>A (p.Arg151His) | single nucleotide variant | Huntington disease-like 1 [RCV002995595] | Chr20:4699672 [GRCh38] Chr20:4680318 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.564G>A (p.Thr188=) | single nucleotide variant | Huntington disease-like 1 [RCV002614387] | Chr20:4699784 [GRCh38] Chr20:4680430 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.402G>C (p.Met134Ile) | single nucleotide variant | Huntington disease-like 1 [RCV002619891] | Chr20:4699622 [GRCh38] Chr20:4680268 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.451C>T (p.Arg151Cys) | single nucleotide variant | Huntington disease-like 1 [RCV003077726] | Chr20:4699671 [GRCh38] Chr20:4680317 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.138C>T (p.Gly46=) | single nucleotide variant | Huntington disease-like 1 [RCV003100235] | Chr20:4699358 [GRCh38] Chr20:4680004 [GRCh37] Chr20:20p13 |
likely benign|uncertain significance |
NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) | microsatellite | Huntington disease-like 1 [RCV002847207] | Chr20:4699379..4699380 [GRCh38] Chr20:4680025..4680026 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.120G>A (p.Gly40=) | single nucleotide variant | Huntington disease-like 1 [RCV002780237] | Chr20:4699340 [GRCh38] Chr20:4679986 [GRCh37] Chr20:20p13 |
benign |
NM_000311.5(PRNP):c.446dup (p.Tyr149Ter) | duplication | Huntington disease-like 1 [RCV002917596] | Chr20:4699665..4699666 [GRCh38] Chr20:4680311..4680312 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.563C>T (p.Thr188Met) | single nucleotide variant | Huntington disease-like 1 [RCV002932164] | Chr20:4699783 [GRCh38] Chr20:4680429 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.286C>G (p.His96Asp) | single nucleotide variant | Inborn genetic diseases [RCV002955060] | Chr20:4699506 [GRCh38] Chr20:4680152 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.393A>G (p.Gly131=) | single nucleotide variant | Huntington disease-like 1 [RCV002624078] | Chr20:4699613 [GRCh38] Chr20:4680259 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.110G>A (p.Arg37Gln) | single nucleotide variant | Inborn genetic diseases [RCV002641730] | Chr20:4699330 [GRCh38] Chr20:4679976 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.505T>C (p.Tyr169His) | single nucleotide variant | Huntington disease-like 1 [RCV002596518] | Chr20:4699725 [GRCh38] Chr20:4680371 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.214G>C (p.Gly72Arg) | single nucleotide variant | Inborn genetic diseases [RCV002915098] | Chr20:4699434 [GRCh38] Chr20:4680080 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.74G>A (p.Arg25His) | single nucleotide variant | Huntington disease-like 1 [RCV002922918] | Chr20:4699294 [GRCh38] Chr20:4679940 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.563C>G (p.Thr188Arg) | single nucleotide variant | Huntington disease-like 1 [RCV003064598] | Chr20:4699783 [GRCh38] Chr20:4680429 [GRCh37] Chr20:20p13 |
likely pathogenic |
NM_000311.5(PRNP):c.441C>T (p.Asp147=) | single nucleotide variant | Huntington disease-like 1 [RCV002589065] | Chr20:4699661 [GRCh38] Chr20:4680307 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.715C>T (p.Pro239Ser) | single nucleotide variant | Huntington disease-like 1 [RCV002654626] | Chr20:4699935 [GRCh38] Chr20:4680581 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.77C>T (p.Pro26Leu) | single nucleotide variant | not provided [RCV004790812] | Chr20:4699297 [GRCh38] Chr20:4679943 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13-12.3(chr20:3034557-5524417)x1 | copy number loss | See cases [RCV003158005] | Chr20:3034557..5524417 [GRCh37] Chr20:20p13-12.3 |
likely pathogenic |
GRCh38/hg38 20p13-11.21(chr20:87153-23635465)x3 | copy number gain | Renal agenesis [RCV003327640] | Chr20:87153..23635465 [GRCh38] Chr20:20p13-11.21 |
pathogenic |
NM_000311.5(PRNP):c.432C>G (p.Asp144Glu) | single nucleotide variant | not provided [RCV003327084] | Chr20:4699652 [GRCh38] Chr20:4680298 [GRCh37] Chr20:20p13 |
uncertain significance |
GRCh37/hg19 20p13-12.2(chr20:61569-9542361)x3 | copy number gain | not provided [RCV003485207] | Chr20:61569..9542361 [GRCh37] Chr20:20p13-12.2 |
pathogenic |
NM_000311.5(PRNP):c.180TCATGGTGGTGGCTGGGGGCAGCC[3] (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGln) | microsatellite | not provided [RCV003480348] | Chr20:4699379..4699380 [GRCh38] Chr20:4680025..4680026 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.190G>A (p.Gly64Ser) | single nucleotide variant | not provided [RCV004790813] | Chr20:4699410 [GRCh38] Chr20:4680056 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.705CTC[1] (p.Ser237del) | microsatellite | not provided [RCV003431253] | Chr20:4699925..4699927 [GRCh38] Chr20:4680571..4680573 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.423C>T (p.Phe141=) | single nucleotide variant | Huntington disease-like 1 [RCV003627104] | Chr20:4699643 [GRCh38] Chr20:4680289 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.350_351inv (p.Ala117Val) | inversion | Huntington disease-like 1 [RCV003627888] | Chr20:4699570..4699571 [GRCh38] Chr20:4680216..4680217 [GRCh37] Chr20:20p13 |
pathogenic |
NM_000311.5(PRNP):c.674A>G (p.Tyr225Cys) | single nucleotide variant | Huntington disease-like 1 [RCV003626596] | Chr20:4699894 [GRCh38] Chr20:4680540 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.654C>G (p.Tyr218Ter) | single nucleotide variant | Huntington disease-like 1 [RCV003627977] | Chr20:4699874 [GRCh38] Chr20:4680520 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.54C>T (p.Asp18=) | single nucleotide variant | Huntington disease-like 1 [RCV003514214] | Chr20:4699274 [GRCh38] Chr20:4679920 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.487T>C (p.Tyr163His) | single nucleotide variant | Huntington disease-like 1 [RCV003514038] | Chr20:4699707 [GRCh38] Chr20:4680353 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.749T>C (p.Leu250Pro) | single nucleotide variant | Huntington disease-like 1 [RCV003514261] | Chr20:4699969 [GRCh38] Chr20:4680615 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.480A>G (p.Gln160=) | single nucleotide variant | Huntington disease-like 1 [RCV003870363] | Chr20:4699700 [GRCh38] Chr20:4680346 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.*5G>A | single nucleotide variant | PRNP-related disorder [RCV004531875] | Chr20:4699987 [GRCh38] Chr20:4680633 [GRCh37] Chr20:20p13 |
likely benign |
GRCh37/hg19 20p13-12.1(chr20:68351-16142323)x3 | copy number gain | not provided [RCV003885494] | Chr20:68351..16142323 [GRCh37] Chr20:20p13-12.1 |
pathogenic |
GRCh37/hg19 20p13-11.21(chr20:68351-23860313)x3 | copy number gain | not provided [RCV003885495] | Chr20:68351..23860313 [GRCh37] Chr20:20p13-11.21 |
pathogenic |
NC_000020.10:g.(?_3190198)_(6760201_?)del | deletion | Inosine triphosphatase deficiency [RCV004579445] | Chr20:3190198..6760201 [GRCh37] Chr20:20p13-12.3 |
pathogenic |
NM_000311.5(PRNP):c.40G>T (p.Ala14Ser) | single nucleotide variant | Inborn genetic diseases [RCV004660326] | Chr20:4699260 [GRCh38] Chr20:4679906 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.88G>A (p.Gly30Arg) | single nucleotide variant | not provided [RCV004592464] | Chr20:4699308 [GRCh38] Chr20:4679954 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.218G>C (p.Trp73Ser) | single nucleotide variant | not provided [RCV004697436] | Chr20:4699438 [GRCh38] Chr20:4680084 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.666T>G (p.Ser222=) | single nucleotide variant | Huntington disease-like 1 [RCV005067285] | Chr20:4699886 [GRCh38] Chr20:4680532 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.684A>G (p.Arg228=) | single nucleotide variant | Huntington disease-like 1 [RCV005195208] | Chr20:4699904 [GRCh38] Chr20:4680550 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.576C>T (p.Thr192=) | single nucleotide variant | Huntington disease-like 1 [RCV005127233] | Chr20:4699796 [GRCh38] Chr20:4680442 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.33C>T (p.Leu11=) | single nucleotide variant | Huntington disease-like 1 [RCV005157176] | Chr20:4699253 [GRCh38] Chr20:4679899 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.162T>C (p.Gly54=) | single nucleotide variant | Huntington disease-like 1 [RCV005165031] | Chr20:4699382 [GRCh38] Chr20:4680028 [GRCh37] Chr20:20p13 |
likely benign |
NM_000311.5(PRNP):c.304C>T (p.Pro102Ser) | single nucleotide variant | Gerstmann-Straussler-Scheinker syndrome [RCV005358146] | Chr20:4699524 [GRCh38] Chr20:4680170 [GRCh37] Chr20:20p13 |
likely pathogenic |
NM_000311.5(PRNP):c.166G>A (p.Gly56Ser) | single nucleotide variant | Inborn genetic diseases [RCV005258650] | Chr20:4699386 [GRCh38] Chr20:4680032 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.244G>A (p.Gly82Arg) | single nucleotide variant | Inborn genetic diseases [RCV005258652] | Chr20:4699464 [GRCh38] Chr20:4680110 [GRCh37] Chr20:20p13 |
uncertain significance |
NM_000311.5(PRNP):c.209G>T (p.Gly70Val) | single nucleotide variant | Inborn genetic diseases [RCV005258651] | Chr20:4699429 [GRCh38] Chr20:4680075 [GRCh37] Chr20:20p13 |
uncertain significance |
The detailed report is available here: | ![]() | Full Report | ![]() | CSV | ![]() | TAB | ![]() | Printer |
miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/). For more information about miRGate, see PMID:25858286 or access the full paper here. |
The following QTLs overlap with this region. | ![]() | Full Report | ![]() | CSV | ![]() | TAB | ![]() | Printer | ![]() | Gviewer |
WI-18738 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
SGC44304 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
GDB:181561 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
GDB:607655 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP-2 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
PMC136957P1 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
D20S1014 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
PRNP |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH71030 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH47809 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH70248 |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
RH71032 |
|
adipose tissue
|
alimentary part of gastrointestinal system
|
appendage
|
circulatory system
|
ectoderm
|
endocrine system
|
endoderm
|
entire extraembryonic component
|
exocrine system
|
hemolymphoid system
|
hepatobiliary system
|
integumental system
|
mesenchyme
|
mesoderm
|
musculoskeletal system
|
nervous system
|
pharyngeal arch
|
renal system
|
reproductive system
|
respiratory system
|
sensory system
|
visual system
|
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1204 | 2438 | 2788 | 2253 | 4974 | 1726 | 2351 | 6 | 624 | 1951 | 465 | 2270 | 7306 | 6472 | 53 | 3734 | 1 | 852 | 1744 | 1617 | 175 | 1 |
RefSeq Transcripts | NG_009087 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
NM_000311 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001080121 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001080122 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001080123 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_001271561 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
NM_183079 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
GenBank Nucleotide | AB300823 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
AB300824 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AB300825 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AB300826 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AF030575 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AF076976 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AF085477 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AF315723 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AI131269 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AJ289875 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK090575 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK293312 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK295415 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK295943 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AK312276 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AL133396 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AW452130 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AY008282 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AY219882 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AY219883 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AY458651 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
AY569456 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BC012844 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BC016809 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BC022532 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BG397054 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BI669189 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BK007887 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BP251427 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
BT019496 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CH471133 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CP068258 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CR542039 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
CR542072 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
D00015 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DA122620 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DA297032 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DB461478 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DB485147 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DC325819 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
DQ408531 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
EF139172 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
GU564468 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
HM459606 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
LC550028 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
LC574065 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
LC842280 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
LC842281 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
M13667 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
M13899 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
M81929 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
M81930 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423298 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423299 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423300 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423301 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423302 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423303 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423304 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423305 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423306 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423307 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423308 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423309 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423310 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423311 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423312 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423313 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423314 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423315 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423316 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423317 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423318 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423319 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423320 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423321 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423322 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423323 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423324 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423325 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423326 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423327 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423328 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423329 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423330 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423331 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423332 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423333 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423334 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423335 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423336 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423337 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423338 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423339 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423340 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423341 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423342 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423343 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423344 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423345 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423346 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423347 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423348 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423349 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423350 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423351 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423352 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423353 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423354 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423355 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423356 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423357 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423358 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423359 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423360 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423361 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423362 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423363 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423364 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423365 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423366 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423367 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423368 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423369 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423370 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423371 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423372 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423373 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423374 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423375 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423376 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423377 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423378 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423379 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423380 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423381 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423382 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423383 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423384 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423385 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423386 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423387 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423388 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423389 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423390 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423391 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423392 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423393 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423394 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423395 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423396 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423397 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423398 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423399 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423400 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423401 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423402 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423403 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423404 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423405 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423406 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423407 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423408 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423409 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423410 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423411 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423412 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423413 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423414 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423415 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
ON423416 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S71208 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S71210 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S71212 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S79978 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S80539 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S80732 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S80743 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S82948 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
S83341 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
U29185 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
X82545 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles | |
X83416 | (Get FASTA) | NCBI Sequence Viewer | Search GEO for Microarray Profiles |
Ensembl Acc Id: | ENST00000379440 ⟹ ENSP00000368752 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000424424 ⟹ ENSP00000411599 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000430350 ⟹ ENSP00000399376 | ||||||||
Type: | CODING | ||||||||
Position: |
|
Ensembl Acc Id: | ENST00000457586 ⟹ ENSP00000415284 | ||||||||
Type: | CODING | ||||||||
Position: |
|
RefSeq Acc Id: | NM_000311 ⟹ NP_000302 | ||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NM_001080121 ⟹ NP_001073590 | ||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NM_001080122 ⟹ NP_001073591 | ||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NM_001080123 ⟹ NP_001073592 | ||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NM_001271561 ⟹ NP_001258490 | ||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||
Sequence: |
RefSeq Acc Id: | NM_183079 ⟹ NP_898902 | ||||||||||||||||||||||||||||
RefSeq Status: | REVIEWED | ||||||||||||||||||||||||||||
Type: | CODING | ||||||||||||||||||||||||||||
Position: |
|
||||||||||||||||||||||||||||
Sequence: |
Protein RefSeqs | NP_000302 | (Get FASTA) | NCBI Sequence Viewer |
NP_001073590 | (Get FASTA) | NCBI Sequence Viewer | |
NP_001073591 | (Get FASTA) | NCBI Sequence Viewer | |
NP_001073592 | (Get FASTA) | NCBI Sequence Viewer | |
NP_001258490 | (Get FASTA) | NCBI Sequence Viewer | |
NP_898902 | (Get FASTA) | NCBI Sequence Viewer | |
GenBank Protein | AAA19664 | (Get FASTA) | NCBI Sequence Viewer |
AAA60182 | (Get FASTA) | NCBI Sequence Viewer | |
AAB20521 | (Get FASTA) | NCBI Sequence Viewer | |
AAB20522 | (Get FASTA) | NCBI Sequence Viewer | |
AAB20523 | (Get FASTA) | NCBI Sequence Viewer | |
AAB21334 | (Get FASTA) | NCBI Sequence Viewer | |
AAB35416 | (Get FASTA) | NCBI Sequence Viewer | |
AAB50648 | (Get FASTA) | NCBI Sequence Viewer | |
AAB50649 | (Get FASTA) | NCBI Sequence Viewer | |
AAB50777 | (Get FASTA) | NCBI Sequence Viewer | |
AAB59442 | (Get FASTA) | NCBI Sequence Viewer | |
AAB59443 | (Get FASTA) | NCBI Sequence Viewer | |
AAC05365 | (Get FASTA) | NCBI Sequence Viewer | |
AAC62750 | (Get FASTA) | NCBI Sequence Viewer | |
AAC78725 | (Get FASTA) | NCBI Sequence Viewer | |
AAD15012 | (Get FASTA) | NCBI Sequence Viewer | |
AAD46098 | (Get FASTA) | NCBI Sequence Viewer | |
AAG21693 | (Get FASTA) | NCBI Sequence Viewer | |
AAH12844 | (Get FASTA) | NCBI Sequence Viewer | |
AAH22532 | (Get FASTA) | NCBI Sequence Viewer | |
AAO83635 | (Get FASTA) | NCBI Sequence Viewer | |
AAO83636 | (Get FASTA) | NCBI Sequence Viewer | |
AAR21603 | (Get FASTA) | NCBI Sequence Viewer | |
AAS80162 | (Get FASTA) | NCBI Sequence Viewer | |
AAV38303 | (Get FASTA) | NCBI Sequence Viewer | |
ABD63004 | (Get FASTA) | NCBI Sequence Viewer | |
ABL75508 | (Get FASTA) | NCBI Sequence Viewer | |
ADD71057 | (Get FASTA) | NCBI Sequence Viewer | |
ADO16981 | (Get FASTA) | NCBI Sequence Viewer | |
BAA00011 | (Get FASTA) | NCBI Sequence Viewer | |
BAG32276 | (Get FASTA) | NCBI Sequence Viewer | |
BAG32277 | (Get FASTA) | NCBI Sequence Viewer | |
BAG32278 | (Get FASTA) | NCBI Sequence Viewer | |
BAG32279 | (Get FASTA) | NCBI Sequence Viewer | |
BAG35206 | (Get FASTA) | NCBI Sequence Viewer | |
BAG52189 | (Get FASTA) | NCBI Sequence Viewer | |
BAG56832 | (Get FASTA) | NCBI Sequence Viewer | |
BAG58365 | (Get FASTA) | NCBI Sequence Viewer | |
BAG58727 | (Get FASTA) | NCBI Sequence Viewer | |
BCG28117 | (Get FASTA) | NCBI Sequence Viewer | |
BCK59655 | (Get FASTA) | NCBI Sequence Viewer | |
CAA57895 | (Get FASTA) | NCBI Sequence Viewer | |
CAA58442 | (Get FASTA) | NCBI Sequence Viewer | |
CAG46836 | (Get FASTA) | NCBI Sequence Viewer | |
CAG46869 | (Get FASTA) | NCBI Sequence Viewer | |
DAA34790 | (Get FASTA) | NCBI Sequence Viewer | |
EAX10449 | (Get FASTA) | NCBI Sequence Viewer | |
EAX10450 | (Get FASTA) | NCBI Sequence Viewer | |
Ensembl Protein | ENSP00000368752 | ||
ENSP00000368752.4 | |||
ENSP00000399376 | |||
ENSP00000399376.2 | |||
ENSP00000411599 | |||
ENSP00000411599.2 | |||
ENSP00000415284 | |||
ENSP00000415284.2 | |||
GenBank Protein | F7VJQ1 | (Get FASTA) | NCBI Sequence Viewer |
P04156 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09589 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09590 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09591 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09592 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09593 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09594 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09595 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09596 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09597 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09598 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09599 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09600 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09601 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09602 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09603 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09604 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09605 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09606 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09607 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09608 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09609 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09610 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09611 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09612 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09613 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09614 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09615 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09616 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09617 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09618 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09619 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09620 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09621 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09622 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09623 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09624 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09625 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09626 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09627 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09628 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09629 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09630 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09631 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09632 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09633 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09634 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09635 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09636 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09637 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09638 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09639 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09640 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09641 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09642 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09643 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09644 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09645 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09646 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09647 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09648 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09649 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09650 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09651 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09652 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09653 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09654 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09655 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09656 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09657 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09658 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09659 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09660 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09661 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09662 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09663 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09664 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09665 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09666 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09667 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09668 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09669 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09670 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09671 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09672 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09673 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09674 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09675 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09676 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09677 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09678 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09679 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09680 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09681 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09682 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09683 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09684 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09685 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09686 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09687 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09688 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09689 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09690 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09691 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09692 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09693 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09694 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09695 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09696 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09697 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09698 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09699 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09700 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09701 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09702 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09703 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09704 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09705 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09706 | (Get FASTA) | NCBI Sequence Viewer | |
URQ09707 | (Get FASTA) | NCBI Sequence Viewer |
RefSeq Acc Id: | NP_000302 ⟸ NM_000311 |
- Peptide Label: | preproprotein Prp precursor |
- UniProtKB: | Q96E70 (UniProtKB/Swiss-Prot), Q8TBG0 (UniProtKB/Swiss-Prot), Q5QPB4 (UniProtKB/Swiss-Prot), Q27H91 (UniProtKB/Swiss-Prot), Q15221 (UniProtKB/Swiss-Prot), Q15216 (UniProtKB/Swiss-Prot), P78446 (UniProtKB/Swiss-Prot), O60489 (UniProtKB/Swiss-Prot), Q9UP19 (UniProtKB/Swiss-Prot), P04156 (UniProtKB/Swiss-Prot), Q53YK7 (UniProtKB/TrEMBL), A0A6J4EE43 (UniProtKB/TrEMBL), B2R5Q9 (UniProtKB/TrEMBL), Q6FGN5 (UniProtKB/TrEMBL) |
- Sequence: |
RefSeq Acc Id: | NP_001073590 ⟸ NM_001080121 |
- Peptide Label: | preproprotein Prp precursor |
- UniProtKB: | Q96E70 (UniProtKB/Swiss-Prot), Q8TBG0 (UniProtKB/Swiss-Prot), Q5QPB4 (UniProtKB/Swiss-Prot), Q27H91 (UniProtKB/Swiss-Prot), Q15221 (UniProtKB/Swiss-Prot), Q15216 (UniProtKB/Swiss-Prot), P78446 (UniProtKB/Swiss-Prot), O60489 (UniProtKB/Swiss-Prot), Q9UP19 (UniProtKB/Swiss-Prot), P04156 (UniProtKB/Swiss-Prot), Q53YK7 (UniProtKB/TrEMBL), A0A6J4EE43 (UniProtKB/TrEMBL), B2R5Q9 (UniProtKB/TrEMBL), Q6FGN5 (UniProtKB/TrEMBL) |
- Sequence: |
RefSeq Acc Id: | NP_898902 ⟸ NM_183079 |
- Peptide Label: | preproprotein Prp precursor |
- UniProtKB: | Q96E70 (UniProtKB/Swiss-Prot), Q8TBG0 (UniProtKB/Swiss-Prot), Q5QPB4 (UniProtKB/Swiss-Prot), Q27H91 (UniProtKB/Swiss-Prot), Q15221 (UniProtKB/Swiss-Prot), Q15216 (UniProtKB/Swiss-Prot), P78446 (UniProtKB/Swiss-Prot), O60489 (UniProtKB/Swiss-Prot), Q9UP19 (UniProtKB/Swiss-Prot), P04156 (UniProtKB/Swiss-Prot), Q53YK7 (UniProtKB/TrEMBL), A0A6J4EE43 (UniProtKB/TrEMBL), B2R5Q9 (UniProtKB/TrEMBL), Q6FGN5 (UniProtKB/TrEMBL) |
- Sequence: |
RefSeq Acc Id: | NP_001073591 ⟸ NM_001080122 |
- Peptide Label: | preproprotein Prp precursor |
- UniProtKB: | Q96E70 (UniProtKB/Swiss-Prot), Q8TBG0 (UniProtKB/Swiss-Prot), Q5QPB4 (UniProtKB/Swiss-Prot), Q27H91 (UniProtKB/Swiss-Prot), Q15221 (UniProtKB/Swiss-Prot), Q15216 (UniProtKB/Swiss-Prot), P78446 (UniProtKB/Swiss-Prot), O60489 (UniProtKB/Swiss-Prot), Q9UP19 (UniProtKB/Swiss-Prot), P04156 (UniProtKB/Swiss-Prot), Q53YK7 (UniProtKB/TrEMBL), A0A6J4EE43 (UniProtKB/TrEMBL), B2R5Q9 (UniProtKB/TrEMBL), Q6FGN5 (UniProtKB/TrEMBL) |
- Sequence: |
RefSeq Acc Id: | NP_001073592 ⟸ NM_001080123 |
- Peptide Label: | preproprotein Prp precursor |
- UniProtKB: | Q96E70 (UniProtKB/Swiss-Prot), Q8TBG0 (UniProtKB/Swiss-Prot), Q5QPB4 (UniProtKB/Swiss-Prot), Q27H91 (UniProtKB/Swiss-Prot), Q15221 (UniProtKB/Swiss-Prot), Q15216 (UniProtKB/Swiss-Prot), P78446 (UniProtKB/Swiss-Prot), O60489 (UniProtKB/Swiss-Prot), Q9UP19 (UniProtKB/Swiss-Prot), P04156 (UniProtKB/Swiss-Prot), Q53YK7 (UniProtKB/TrEMBL), A0A6J4EE43 (UniProtKB/TrEMBL), B2R5Q9 (UniProtKB/TrEMBL), Q6FGN5 (UniProtKB/TrEMBL) |
- Sequence: |
RefSeq Acc Id: | NP_001258490 ⟸ NM_001271561 |
- Peptide Label: | isoform AltPrp |
- UniProtKB: | F7VJQ1 (UniProtKB/Swiss-Prot), K0P2W7 (UniProtKB/TrEMBL) |
- Sequence: |
Ensembl Acc Id: | ENSP00000411599 ⟸ ENST00000424424 |
Ensembl Acc Id: | ENSP00000415284 ⟸ ENST00000457586 |
Ensembl Acc Id: | ENSP00000368752 ⟸ ENST00000379440 |
Ensembl Acc Id: | ENSP00000399376 ⟸ ENST00000430350 |
Name | Modeler | Protein Id | AA Range | Protein Structure |
AF-P04156-F1-model_v2 | AlphaFold | P04156 | 1-253 | view protein structure |
RGD ID: | 6798912 | ||||||||
Promoter ID: | HG_KWN:38471 | ||||||||
Type: | CpG-Island | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | MPROMDB | ||||||||
Tissues & Cell Lines: | CD4+TCell, CD4+TCell_12Hour, HeLa_S3, K562, Lymphoblastoid, NB4 | ||||||||
Transcripts: | NM_001080121, NM_001080122, NM_001080123, OTTHUMT00000077820, OTTHUMT00000077821, UC002WKT.1 | ||||||||
Position: |
|
RGD ID: | 6850760 | ||||||||
Promoter ID: | EP73174 | ||||||||
Type: | multiple initiation site | ||||||||
Name: | HS_PRNP | ||||||||
Description: | Prion protein (p27-30) (Creutzfeld-Jakob disease,Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia). | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPD (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Experiment Methods: | NEDO full length human cDNA sequencing project.; Oligo-capping | ||||||||
Position: |
|
RGD ID: | 13206283 | ||||||||
Promoter ID: | EPDNEW_H26722 | ||||||||
Type: | initiation region | ||||||||
Name: | PRNP_1 | ||||||||
Description: | prion protein | ||||||||
SO ACC ID: | SO:0000170 | ||||||||
Source: | EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/) | ||||||||
Experiment Methods: | Single-end sequencing. | ||||||||
Position: |
|
Database | Acc Id | Source(s) |
AGR Gene | HGNC:9449 | AgrOrtholog |
COSMIC | PRNP | COSMIC |
Ensembl Genes | ENSG00000171867 | Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot |
Ensembl Transcript | ENST00000379440 | ENTREZGENE |
ENST00000379440.9 | UniProtKB/Swiss-Prot | |
ENST00000424424 | ENTREZGENE | |
ENST00000424424.2 | UniProtKB/Swiss-Prot | |
ENST00000430350 | ENTREZGENE | |
ENST00000430350.2 | UniProtKB/Swiss-Prot | |
ENST00000457586 | ENTREZGENE | |
ENST00000457586.2 | UniProtKB/Swiss-Prot | |
Gene3D-CATH | 1.10.790.10 | UniProtKB/Swiss-Prot |
GTEx | ENSG00000171867 | GTEx |
HGNC ID | HGNC:9449 | ENTREZGENE |
Human Proteome Map | PRNP | Human Proteome Map |
InterPro | Prion | UniProtKB/Swiss-Prot |
Prion/Doppel_b-ribbon_dom_sf | UniProtKB/Swiss-Prot | |
Prion/Doppel_prot_b-ribbon_dom | UniProtKB/Swiss-Prot | |
Prion_copper_b_octapeptide | UniProtKB/Swiss-Prot | |
Prion_N_dom | UniProtKB/Swiss-Prot | |
KEGG Report | hsa:5621 | UniProtKB/Swiss-Prot |
NCBI Gene | 5621 | ENTREZGENE |
OMIM | 176640 | OMIM |
PANTHER | DOPPEL PRION | UniProtKB/Swiss-Prot |
MAJOR PRION PROTEIN | UniProtKB/Swiss-Prot | |
Pfam | Prion | UniProtKB/Swiss-Prot |
Prion_bPrPp | UniProtKB/Swiss-Prot | |
Prion_octapep | UniProtKB/Swiss-Prot | |
PharmGKB | PA33796 | PharmGKB |
PRINTS | PRION | UniProtKB/Swiss-Prot |
PROSITE | PRION_1 | UniProtKB/Swiss-Prot |
PRION_2 | UniProtKB/Swiss-Prot | |
SMART | PRP | UniProtKB/Swiss-Prot |
Superfamily-SCOP | SSF54098 | UniProtKB/Swiss-Prot |
UniProt | A0A6J4EE43 | ENTREZGENE, UniProtKB/TrEMBL |
A1YVW6_HUMAN | UniProtKB/TrEMBL | |
A2A2V1_HUMAN | UniProtKB/TrEMBL | |
APRIO_HUMAN | UniProtKB/Swiss-Prot | |
B2NI04_HUMAN | UniProtKB/TrEMBL | |
B2NI05_HUMAN | UniProtKB/TrEMBL | |
B2R5Q9 | ENTREZGENE, UniProtKB/TrEMBL | |
D4P3Q7_HUMAN | UniProtKB/TrEMBL | |
F7VJQ1 | ENTREZGENE | |
K0P2W7 | ENTREZGENE, UniProtKB/TrEMBL | |
O60489 | ENTREZGENE | |
O75942_HUMAN | UniProtKB/TrEMBL | |
P04156 | ENTREZGENE | |
P78446 | ENTREZGENE | |
PRIO_HUMAN | UniProtKB/Swiss-Prot | |
Q15216 | ENTREZGENE | |
Q15221 | ENTREZGENE | |
Q16409_HUMAN | UniProtKB/TrEMBL | |
Q27H91 | ENTREZGENE | |
Q53YK7 | ENTREZGENE, UniProtKB/TrEMBL | |
Q540C4_HUMAN | UniProtKB/TrEMBL | |
Q5QPB4 | ENTREZGENE | |
Q6FGN5 | ENTREZGENE, UniProtKB/TrEMBL | |
Q6FGR8_HUMAN | UniProtKB/TrEMBL | |
Q6SES1_HUMAN | UniProtKB/TrEMBL | |
Q7KYY8_HUMAN | UniProtKB/TrEMBL | |
Q86XR1_HUMAN | UniProtKB/TrEMBL | |
Q8TBG0 | ENTREZGENE | |
Q96E70 | ENTREZGENE | |
Q9UP19 | ENTREZGENE | |
X6RKS3_HUMAN | UniProtKB/TrEMBL | |
UniProt Secondary | O60489 | UniProtKB/Swiss-Prot |
P78446 | UniProtKB/Swiss-Prot | |
Q15216 | UniProtKB/Swiss-Prot | |
Q15221 | UniProtKB/Swiss-Prot | |
Q27H91 | UniProtKB/Swiss-Prot | |
Q5QPB4 | UniProtKB/Swiss-Prot | |
Q8TBG0 | UniProtKB/Swiss-Prot | |
Q96E70 | UniProtKB/Swiss-Prot | |
Q9UP19 | UniProtKB/Swiss-Prot |
Date | Current Symbol | Current Name | Previous Symbol | Previous Name | Description | Reference | Status |
---|---|---|---|---|---|---|---|
2023-12-18 | PRNP | prion protein (Kanno blood group) | PRNP | prion protein | Symbol and/or name change | 19259463 | PROVISIONAL |