PRNP (prion protein (Kanno blood group)) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Gene: PRNP (prion protein (Kanno blood group)) Homo sapiens
Analyze
Symbol: PRNP
Name: prion protein (Kanno blood group)
RGD ID: 737306
HGNC Page HGNC:9449
Description: Enables several functions, including amyloid-beta binding activity; cuprous ion binding activity; and molecular condensate scaffold activity. Involved in several processes, including cellular response to amyloid-beta; positive regulation of signal transduction; and protein destabilization. Acts upstream of or within cellular response to copper ion. Located in several cellular components, including membrane raft; mitochondrial outer membrane; and nuclear membrane. Is active in dendrite. Implicated in Creutzfeldt-Jakob disease; Gerstmann-Straussler-Scheinker syndrome; Huntington's disease-like 1; fatal familial insomnia; and kuru.
Type: protein-coding
RefSeq Status: REVIEWED
Previously known as: alternative prion protein; AltPrP; ASCR; CD230; CD230 antigen; CJD; GSS; KURU; major prion protein; MGC26679; p27-30; prion; prion protein; prion protein (p27-30) (Creutzfeldt-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia); prion protein PrP; prion-related protein; PRIP; PrP; PrP27-30; PrP33-35C; PrPc
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Orthologs
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38204,686,456 - 4,701,588 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p14 Ensembl204,686,350 - 4,701,590 (+)Ensemblhg38GRCh38
GRCh37204,667,102 - 4,682,234 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36204,614,797 - 4,630,234 (+)NCBIBuild 36Build 36hg18NCBI36
Build 34204,615,068 - 4,630,233NCBI
Celera204,736,512 - 4,751,948 (+)NCBICelera
Cytogenetic Map20p13NCBI
HuRef204,620,194 - 4,635,632 (+)NCBIHuRef
CHM1_1204,667,528 - 4,682,967 (+)NCBICHM1_1
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBIT2T-CHM13v2.0
JBrowse:




Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
(+)-schisandrin B  (ISO)
(1->4)-beta-D-glucan  (ISO)
(E)-thiamethoxam  (ISO)
1,2-dichloroethane  (ISO)
1,2-dihexadecanoyl-sn-glycero-3-phosphocholine  (EXP)
1,2-dimethylhydrazine  (ISO)
1-naphthyl isothiocyanate  (ISO)
17alpha-ethynylestradiol  (ISO)
17beta-estradiol  (EXP,ISO)
17beta-hydroxy-5alpha-androstan-3-one  (ISO)
2,2',4,4'-Tetrabromodiphenyl ether  (EXP)
2,2,2-tetramine  (ISO)
2,2,2-trifluoroethanol  (EXP)
2,3,7,8-tetrachlorodibenzodioxine  (ISO)
2,4-dibromophenyl 2,4,5-tribromophenyl ether  (ISO)
2-methoxyethanol  (ISO)
3,3',4,4',5-pentachlorobiphenyl  (ISO)
3,4-dichloroaniline  (EXP)
4,4'-diaminodiphenylmethane  (ISO)
4,4'-sulfonyldiphenol  (EXP,ISO)
5-fluorouracil  (EXP)
acetamide  (ISO)
acetylsalicylic acid  (ISO)
acrylamide  (EXP)
aflatoxin B1  (EXP,ISO)
aldehydo-D-glucose  (EXP)
all-trans-retinoic acid  (EXP,ISO)
allopurinol  (ISO)
ammonium chloride  (ISO)
antirheumatic drug  (EXP)
arsane  (EXP)
arsenic atom  (EXP)
arsenite(3-)  (EXP)
arsenous acid  (EXP)
atrazine  (EXP)
bathocuproine disulfonic acid  (ISO)
benzene  (EXP)
benzo[a]pyrene  (EXP,ISO)
benzo[a]pyrene diol epoxide I  (EXP)
benzoates  (EXP)
beta-lapachone  (EXP)
bexarotene  (ISO)
bis(2-ethylhexyl) phthalate  (ISO)
bisphenol A  (EXP,ISO)
bisphenol AF  (EXP,ISO)
Bisphenol B  (EXP)
bortezomib  (EXP)
butyric acid  (ISO)
cadmium atom  (EXP,ISO)
cadmium dichloride  (EXP,ISO)
caffeine  (EXP)
calcitriol  (EXP)
carbamazepine  (EXP)
carbon nanotube  (ISO)
CGP 52608  (EXP)
chloropicrin  (EXP)
chlorpyrifos  (ISO)
chromium(6+)  (EXP)
cisplatin  (EXP)
Congo Red  (ISO)
copper atom  (EXP,ISO)
copper(0)  (EXP,ISO)
copper(II) chloride  (ISO)
copper(II) sulfate  (EXP,ISO)
cyclosporin A  (EXP,ISO)
cytarabine  (EXP)
D-glucose  (EXP)
diarsenic trioxide  (EXP)
dichloromethane  (EXP)
diethyldithiocarbamic acid  (ISO)
dioxygen  (EXP,ISO)
diuron  (EXP)
dorsomorphin  (EXP)
doxorubicin  (EXP)
edaravone  (ISO)
entinostat  (EXP)
ethyl methanesulfonate  (EXP)
ethylbenzene  (EXP)
ethylenediaminetetraacetic acid  (ISO)
etoposide  (EXP)
fenthion  (ISO)
filipin III  (EXP,ISO)
flutamide  (ISO)
folic acid  (ISO)
formaldehyde  (EXP)
furan  (ISO)
genistein  (EXP,ISO)
gentamycin  (ISO)
glucose  (EXP)
glutathione  (ISO)
glyphosate  (ISO)
graphene oxide  (EXP)
GW 1929  (EXP)
heparan sulfate  (ISO)
hydrogen peroxide  (EXP,ISO)
indoxyl sulfate  (EXP)
inulin  (ISO)
iron atom  (ISO)
iron(0)  (ISO)
lead diacetate  (ISO)
lead tetraacetate  (ISO)
lead(0)  (EXP)
lipopolysaccharide  (ISO)
luzindole  (EXP)
manganese atom  (EXP,ISO)
manganese(0)  (EXP,ISO)
manganese(II) chloride  (EXP,ISO)
melatonin  (EXP)
mercury dibromide  (EXP)
metam  (ISO)
methapyrilene  (ISO)
methotrexate  (EXP)
methyl methanesulfonate  (EXP)
methylmercury chloride  (EXP)
methylseleninic acid  (EXP)
mitomycin C  (EXP)
mono(2-ethylhexyl) phthalate  (EXP)
N,N-diethyl-m-toluamide  (ISO)
N-nitrosodiethylamine  (ISO)
N-nitrosodimethylamine  (ISO)
NADP zwitterion  (EXP,ISO)
NADP(+)  (EXP,ISO)
nickel atom  (EXP,ISO)
nickel sulfate  (EXP)
nitroprusside  (EXP)
nystatin  (EXP,ISO)
o-xylene  (EXP)
oxaliplatin  (ISO)
ozone  (EXP)
panobinostat  (EXP)
paracetamol  (EXP)
paraquat  (ISO)
parathion  (ISO)
perfluorohexanesulfonic acid  (ISO)
perfluorooctane-1-sulfonic acid  (ISO)
perfluorooctanoic acid  (EXP)
permethrin  (ISO)
phenylmercury acetate  (EXP)
pioglitazone  (EXP)
pirinixic acid  (ISO)
progesterone  (EXP)
Pyridostigmine bromide  (ISO)
reactive oxygen species  (EXP,ISO)
resveratrol  (EXP)
SB 431542  (EXP)
silicon dioxide  (ISO)
silver atom  (EXP,ISO)
silver(0)  (EXP,ISO)
sodium arsenite  (EXP)
tamibarotene  (EXP)
tert-butyl hydroperoxide  (EXP)
tetrachloromethane  (ISO)
tetracycline  (EXP)
thapsigargin  (ISO)
thiamethoxam  (ISO)
thioacetamide  (ISO)
titanium dioxide  (ISO)
toluene  (EXP)
topotecan  (ISO)
trichloroethene  (EXP,ISO)
trichostatin A  (EXP)
tunicamycin  (EXP)
urethane  (EXP)
ursodeoxycholic acid  (ISO)
valproic acid  (EXP)
vincristine  (EXP)
zinc atom  (ISO)
zinc oxide  (EXP)
zinc(0)  (ISO)

Gene Ontology Annotations     Click to see Annotation Detail View

Biological Process
amyloid precursor protein metabolic process  (ISO)
cellular response to amyloid-beta  (IEA,IGI)
cellular response to copper ion  (IDA)
cellular response to xenobiotic stimulus  (IEA)
dendritic spine maintenance  (TAS)
intracellular copper ion homeostasis  (NAS)
intracellular signal transduction  (IDA,IEA)
learning or memory  (IEA,ISO,ISS)
long-term memory  (TAS)
negative regulation of activated T cell proliferation  (IEA,ISS)
negative regulation of amyloid precursor protein catabolic process  (IEA,ISS)
negative regulation of amyloid-beta formation  (IEA,ISS)
negative regulation of apoptotic process  (IEA,ISO)
negative regulation of calcineurin-NFAT signaling cascade  (IEA,ISS)
negative regulation of dendritic spine maintenance  (IEA,ISS)
negative regulation of interleukin-17 production  (IEA,ISS)
negative regulation of interleukin-2 production  (IEA,ISS)
negative regulation of long-term synaptic potentiation  (IEA)
negative regulation of protein processing  (TAS)
negative regulation of T cell receptor signaling pathway  (IEA,ISS)
negative regulation of transcription by RNA polymerase II  (IEA,ISS)
negative regulation of type II interferon production  (IEA,ISS)
neuron projection maintenance  (IEA,ISS)
positive regulation of calcium-mediated signaling  (IEA,IGI)
positive regulation of glutamate receptor signaling pathway  (IGI)
positive regulation of neuron apoptotic process  (IMP)
positive regulation of protein localization to plasma membrane  (IEA)
positive regulation of protein targeting to membrane  (IEA,ISS)
protein destabilization  (IMP)
protein homooligomerization  (IEA)
regulation of calcium ion import across plasma membrane  (IEA,ISS)
regulation of cell cycle  (IEA)
regulation of glutamate receptor signaling pathway  (IEA,ISS)
regulation of potassium ion transmembrane transport  (IEA)
regulation of protein localization  (IEA)
response to amyloid-beta  (IEA,ISS)
response to cadmium ion  (IEA,ISO)
response to copper ion  (IEA,ISO)
response to oxidative stress  (IEA,ISS)

Cellular Component

Molecular Pathway Annotations     Click to see Annotation Detail View
Phenotype Annotations     Click to see Annotation Detail View

Human Phenotype
Abdominal symptom  (IAGP)
Abnormal autonomic nervous system physiology  (IAGP)
Abnormal basal ganglia morphology  (IAGP)
Abnormal central sensory function  (IAGP)
Abnormal cerebellum morphology  (IAGP)
Abnormal head movements  (IAGP)
Abnormal pineal melatonin secretion  (IAGP)
Abnormal posturing  (IAGP)
Abnormal pupillary function  (IAGP)
Abnormal pyramidal sign  (IAGP)
Abnormal pyramidal tract morphology  (IAGP)
Abnormal saccadic eye movements  (IAGP)
Abnormal shoulder morphology  (IAGP)
Abnormality of extrapyramidal motor function  (IAGP)
Abnormality of eye movement  (IAGP)
Abnormality of mental function  (IAGP)
Abnormality of ocular smooth pursuit  (IAGP)
Abnormality of vision  (IAGP)
Abnormally slow thought process  (IAGP)
Acroparesthesia  (IAGP)
Adult onset  (IAGP)
Aggressive behavior  (IAGP)
Akinetic mutism  (IAGP)
Amyloidosis of peripheral nerves  (IAGP)
Anxiety  (IAGP)
Apathy  (IAGP)
Aphasia  (IAGP)
Apnea  (IAGP)
Apraxia  (IAGP)
Areflexia  (IAGP)
Astrocytosis  (IAGP)
Ataxia  (IAGP)
Attention deficit hyperactivity disorder  (IAGP)
Atypical behavior  (IAGP)
Autistic behavior  (IAGP)
Autosomal dominant inheritance  (IAGP)
Babinski sign  (IAGP)
Basal ganglia gliosis  (IAGP)
Bradykinesia  (IAGP)
Brain imaging abnormality  (IAGP)
Central nervous system degeneration  (IAGP)
Cerebellar atrophy  (IAGP)
Cerebral cortex with spongiform changes  (IAGP)
Cerebral cortical atrophy  (IAGP)
Chorea  (IAGP)
Clumsiness  (IAGP)
Cognitive impairment  (IAGP)
Confusion  (IAGP)
Constipation  (IAGP)
Deficit in phonologic short-term memory  (IAGP)
Delayed speech and language development  (IAGP)
Delusion  (IAGP)
Dementia  (IAGP)
Depression  (IAGP)
Diffuse spongiform leukoencephalopathy  (IAGP)
Diplopia  (IAGP)
Dysarthria  (IAGP)
Dysesthesia  (IAGP)
Dysmetria  (IAGP)
Dysphagia  (IAGP)
EEG abnormality  (IAGP)
EEG with persistent abnormal rhythmic activity  (IAGP)
EEG with spike-wave complexes  (IAGP)
Emotional lability  (IAGP)
Encephalopathy  (IAGP)
Epiphora  (IAGP)
Extrapyramidal muscular rigidity  (IAGP)
Fever  (IAGP)
Focal T2 hyperintense basal ganglia lesion  (IAGP)
Frequent falls  (IAGP)
Gait ataxia  (IAGP)
Gait disturbance  (IAGP)
Generalized hypotonia  (IAGP)
Gliosis  (IAGP)
Global brain atrophy  (IAGP)
Hallucinations  (IAGP)
Hemiparesis  (IAGP)
Hyperactive deep tendon reflexes  (IAGP)
Hyperhidrosis  (IAGP)
Hyperorality  (IAGP)
Hyperreflexia  (IAGP)
Hypersomnia  (IAGP)
Hypertension  (IAGP)
Hypokinesia  (IAGP)
Impaired smooth pursuit  (IAGP)
Incoordination  (IAGP)
Increased circulating cortisol level  (IAGP)
Increased CSF protein concentration  (IAGP)
Insomnia  (IAGP)
Involuntary movements  (IAGP)
Irritability  (IAGP)
Jaw pain  (IAGP)
Jerky head movements  (IAGP)
Jerky ocular pursuit movements  (IAGP)
Laryngeal stridor  (IAGP)
Late young adult onset  (IAGP)
Limb ataxia  (IAGP)
Limb myoclonus  (IAGP)
Loss of facial expression  (IAGP)
Loss of speech  (IAGP)
Lower limb muscle weakness  (IAGP)
Mania  (IAGP)
Mask-like facies  (IAGP)
Memory impairment  (IAGP)
Mental deterioration  (IAGP)
Middle age onset  (IAGP)
Muscle weakness  (IAGP)
Myoclonus  (IAGP)
Neurofibrillary tangles  (IAGP)
Neuronal loss in central nervous system  (IAGP)
Nystagmus  (IAGP)
Paresthesia  (IAGP)
Parkinsonism  (IAGP)
Perseverative thought  (IAGP)
Personality changes  (IAGP)
Poor fine motor coordination  (IAGP)
Poor visual behavior for age  (IAGP)
Progressive cerebellar ataxia  (IAGP)
Progressive extrapyramidal muscular rigidity  (IAGP)
Progressive forgetfulness  (IAGP)
Psychosis  (IAGP)
Rapidly progressive  (IAGP)
Reduced attention regulation  (IAGP)
Reduced tendon reflexes  (IAGP)
Restlessness  (IAGP)
Rigidity  (IAGP)
Seizure  (IAGP)
Senile plaques  (IAGP)
Short attention span  (IAGP)
Short REM sleep  (IAGP)
Short term memory impairment  (IAGP)
Simultanapraxia  (IAGP)
Sleep abnormality  (IAGP)
Sleep apnea  (IAGP)
Sleep-wake cycle disturbance  (IAGP)
Slow saccadic eye movements  (IAGP)
Slurred speech  (IAGP)
Spastic dysarthria  (IAGP)
Spastic hemiparesis  (IAGP)
Spasticity  (IAGP)
Specific learning disability  (IAGP)
Stroke-like episode  (IAGP)
Supranuclear gaze palsy  (IAGP)
Tachycardia  (IAGP)
Thalamic hypometabolism in FDG PET  (IAGP)
Tremor  (IAGP)
Trigeminal neuralgia  (IAGP)
Truncal ataxia  (IAGP)
Unsteady gait  (IAGP)
Urinary retention  (IAGP)
Ventriculomegaly  (IAGP)
Vestibular nystagmus  (IAGP)
Visual impairment  (IAGP)
Weight loss  (IAGP)
Young adult onset  (IAGP)
References

References - curated
# Reference Title Reference Citation
1. Regulators of Iron Homeostasis: New Players in Metabolism, Cell Death, and Disease. Bogdan AR, etal., Trends Biochem Sci. 2016 Mar;41(3):274-86. doi: 10.1016/j.tibs.2015.11.012. Epub 2015 Dec 23.
2. GOAs Human GO annotations GOA_HUMAN data from the GO Consortium
3. Creutzfeldt-Jacob disease associated with the PRNP codon 200Lys mutation: an analysis of 45 families. Goldfarb LG, etal., Eur J Epidemiol. 1991 Sep;7(5):477-86.
4. A novel vector for transgenesis in the rat CNS. Lopez TP, etal., Acta Neuropathol Commun. 2017 Nov 21;5(1):84. doi: 10.1186/s40478-017-0484-y.
5. OMIM Disease Annotation Pipeline OMIM Disease Annotation Pipeline
6. KEGG Annotation Import Pipeline Pipeline to import KEGG annotations from KEGG into RGD
7. PID Annotation Import Pipeline Pipeline to import Pathway Interaction Database annotations from NCI into RGD
8. ClinVar Automated Import and Annotation Pipeline RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
9. Data Import for Chemical-Gene Interactions RGD automated import pipeline for gene-chemical interactions
10. RGD HPO Phenotype Annotation Pipeline RGD automated import pipeline for human HPO-to-gene-to-disease annotations
11. Pronounced cytosolic aggregation of cellular prion protein in pancreatic beta-cells in response to hyperglycemia. Strom A, etal., Lab Invest. 2006 Dec 4;.
Additional References at PubMed
PMID:1346338   PMID:1347910   PMID:1351748   PMID:1352724   PMID:1357663   PMID:1363802   PMID:1363810   PMID:1439789   PMID:1671440   PMID:1672107   PMID:1677164   PMID:1678248  
PMID:1683708   PMID:1736177   PMID:2159587   PMID:2180366   PMID:2564168   PMID:2567794   PMID:2572450   PMID:2783132   PMID:3014653   PMID:3755672   PMID:7485229   PMID:7572084  
PMID:7592679   PMID:7630420   PMID:7642585   PMID:7699395   PMID:7783876   PMID:7902693   PMID:7902972   PMID:7906019   PMID:7913755   PMID:8105771   PMID:8364585   PMID:8461023  
PMID:8676499   PMID:8797471   PMID:8797472   PMID:8909447   PMID:8962161   PMID:9266722   PMID:9384372   PMID:9473220   PMID:9482303   PMID:9786248   PMID:9799790   PMID:10090891  
PMID:10581485   PMID:10618385   PMID:10631141   PMID:10790216   PMID:10900000   PMID:10954699   PMID:10970892   PMID:10987652   PMID:10988071   PMID:11032800   PMID:11032878   PMID:11060296  
PMID:11062072   PMID:11100730   PMID:11120925   PMID:11161453   PMID:11220690   PMID:11244488   PMID:11278562   PMID:11283320   PMID:11438139   PMID:11559357   PMID:11571277   PMID:11584448  
PMID:11593450   PMID:11684342   PMID:11704923   PMID:11709001   PMID:11756421   PMID:11775001   PMID:11780052   PMID:11787070   PMID:11833672   PMID:11840201   PMID:11882649   PMID:11900542  
PMID:11961239   PMID:11986958   PMID:12034503   PMID:12070046   PMID:12084159   PMID:12093732   PMID:12161431   PMID:12186633   PMID:12205650   PMID:12356762   PMID:12356908   PMID:12359724  
PMID:12392052   PMID:12399017   PMID:12459456   PMID:12464104   PMID:12477932   PMID:12514748   PMID:12543108   PMID:12547204   PMID:12568340   PMID:12590162   PMID:12601712   PMID:12621436  
PMID:12645301   PMID:12659837   PMID:12679034   PMID:12679875   PMID:12682740   PMID:12684540   PMID:12690204   PMID:12692258   PMID:12694397   PMID:12719777   PMID:12778138   PMID:12796830  
PMID:12805563   PMID:12867116   PMID:12917418   PMID:12917444   PMID:12946346   PMID:12952977   PMID:12970341   PMID:14519851   PMID:14576159   PMID:14593432   PMID:14610121   PMID:14616310  
PMID:14623188   PMID:14645231   PMID:14668351   PMID:14702039   PMID:14744790   PMID:14745079   PMID:14761942   PMID:14970845   PMID:14983221   PMID:15050367   PMID:15123682   PMID:15131108  
PMID:15140132   PMID:15145944   PMID:15146195   PMID:15148589   PMID:15203115   PMID:15208260   PMID:15215178   PMID:15247220   PMID:15258222   PMID:15266305   PMID:15277640   PMID:15304595  
PMID:15342556   PMID:15469448   PMID:15488240   PMID:15489334   PMID:15539564   PMID:15555583   PMID:15557533   PMID:15583862   PMID:15591591   PMID:15609351   PMID:15639746   PMID:15684434  
PMID:15748158   PMID:15775715   PMID:15837581   PMID:15846375   PMID:15850959   PMID:15862295   PMID:15946217   PMID:15987701   PMID:15997418   PMID:16004966   PMID:16009550   PMID:16025285  
PMID:16051190   PMID:16099550   PMID:16099923   PMID:16119432   PMID:16120605   PMID:16156720   PMID:16159877   PMID:16169070   PMID:16175355   PMID:16187142   PMID:16192387   PMID:16215457  
PMID:16215462   PMID:16217673   PMID:16254249   PMID:16263114   PMID:16286452   PMID:16287045   PMID:16294306   PMID:16298483   PMID:16314483   PMID:16315279   PMID:16324095   PMID:16342955  
PMID:16344560   PMID:16432880   PMID:16434486   PMID:16443601   PMID:16460908   PMID:16478730   PMID:16519692   PMID:16533975   PMID:16537913   PMID:16543824   PMID:16545382   PMID:16547836  
PMID:16580884   PMID:16582585   PMID:16672189   PMID:16674609   PMID:16704797   PMID:16713569   PMID:16750169   PMID:16764594   PMID:16824036   PMID:16825951   PMID:16825956   PMID:16831968  
PMID:16847141   PMID:16847689   PMID:16858508   PMID:16889908   PMID:16897605   PMID:16908519   PMID:16914329   PMID:16921242   PMID:16925523   PMID:16934224   PMID:16950206   PMID:16987816  
PMID:17023178   PMID:17029361   PMID:17047093   PMID:17092648   PMID:17121821   PMID:17134829   PMID:17149767   PMID:17156017   PMID:17192785   PMID:17202849   PMID:17242357   PMID:17260961  
PMID:17276393   PMID:17313881   PMID:17334659   PMID:17385076   PMID:17409275   PMID:17410475   PMID:17414209   PMID:17449139   PMID:17472702   PMID:17497959   PMID:17500595   PMID:17519231  
PMID:17539938   PMID:17559305   PMID:17560545   PMID:17570906   PMID:17709704   PMID:17822808   PMID:17827389   PMID:17873292   PMID:17965961   PMID:17987393   PMID:17996224   PMID:18006836  
PMID:18025469   PMID:18029348   PMID:18038270   PMID:18051367   PMID:18188498   PMID:18191917   PMID:18204788   PMID:18217885   PMID:18218718   PMID:18236005   PMID:18236081   PMID:18247504  
PMID:18275852   PMID:18325785   PMID:18332630   PMID:18347820   PMID:18349519   PMID:18372408   PMID:18406463   PMID:18413481   PMID:18419754   PMID:18423780   PMID:18425766   PMID:18436646  
PMID:18443555   PMID:18445040   PMID:18478114   PMID:18482256   PMID:18505059   PMID:18508914   PMID:18539633   PMID:18549395   PMID:18549399   PMID:18563793   PMID:18597782   PMID:18619462  
PMID:18638557   PMID:18665216   PMID:18691383   PMID:18706660   PMID:18720902   PMID:18722532   PMID:18786636   PMID:18810471   PMID:18830724   PMID:18930924   PMID:18955686   PMID:18959744  
PMID:18990686   PMID:19008948   PMID:19010951   PMID:19030774   PMID:19035579   PMID:19051123   PMID:19056496   PMID:19056867   PMID:19064990   PMID:19074151   PMID:19077115   PMID:19081515  
PMID:19099191   PMID:19129193   PMID:19140013   PMID:19156168   PMID:19158507   PMID:19164910   PMID:19172188   PMID:19196429   PMID:19204171   PMID:19204296   PMID:19210573   PMID:19212444  
PMID:19218199   PMID:19226372   PMID:19228673   PMID:19242475   PMID:19249347   PMID:19278656   PMID:19321423   PMID:19327369   PMID:19351416   PMID:19363267   PMID:19369250   PMID:19416900  
PMID:19476383   PMID:19477226   PMID:19495414   PMID:19524515   PMID:19534429   PMID:19542614   PMID:19556894   PMID:19558790   PMID:19581412   PMID:19583442   PMID:19587281   PMID:19597535  
PMID:19601795   PMID:19602567   PMID:19606064   PMID:19607920   PMID:19643043   PMID:19675240   PMID:19690385   PMID:19696976   PMID:19697238   PMID:19698114   PMID:19709627   PMID:19710507  
PMID:19725833   PMID:19728151   PMID:19734292   PMID:19786843   PMID:19807656   PMID:19822779   PMID:19882604   PMID:19889475   PMID:19910028   PMID:19911184   PMID:19917818   PMID:19923577  
PMID:19927125   PMID:19996123   PMID:20004419   PMID:20005032   PMID:20028338   PMID:20035629   PMID:20036811   PMID:20036833   PMID:20049591   PMID:20077484   PMID:20105449   PMID:20109837  
PMID:20145049   PMID:20175205   PMID:20195363   PMID:20198483   PMID:20301407   PMID:20392961   PMID:20413850   PMID:20422111   PMID:20453509   PMID:20465257   PMID:20473510   PMID:20487506  
PMID:20506117   PMID:20515742   PMID:20515743   PMID:20515747   PMID:20526338   PMID:20526696   PMID:20529115   PMID:20541558   PMID:20547212   PMID:20547859   PMID:20552563   PMID:20562404  
PMID:20564047   PMID:20564346   PMID:20573963   PMID:20574532   PMID:20576610   PMID:20583301   PMID:20583902   PMID:20592456   PMID:20593190   PMID:20613639   PMID:20650901   PMID:20661422  
PMID:20685658   PMID:20694796   PMID:20711061   PMID:20718410   PMID:20724601   PMID:20799315   PMID:20804519   PMID:20816195   PMID:20837487   PMID:20838930   PMID:20861579   PMID:20870462  
PMID:20880607   PMID:20919751   PMID:20923664   PMID:20930299   PMID:20932979   PMID:20949975   PMID:20964628   PMID:20970434   PMID:21029243   PMID:21058033   PMID:21062360   PMID:21071944  
PMID:21094273   PMID:21107135   PMID:21107851   PMID:21116546   PMID:21119307   PMID:21193246   PMID:21209079   PMID:21212268   PMID:21232818   PMID:21257747   PMID:21265952   PMID:21293298  
PMID:21296677   PMID:21297264   PMID:21298055   PMID:21301993   PMID:21320996   PMID:21323366   PMID:21338080   PMID:21356381   PMID:21385869   PMID:21439722   PMID:21445238   PMID:21451573  
PMID:21453198   PMID:21478263   PMID:21478678   PMID:21508834   PMID:21552571   PMID:21559407   PMID:21593310   PMID:21597335   PMID:21600043   PMID:21616973   PMID:21631281   PMID:21654203  
PMID:21689534   PMID:21743439   PMID:21763357   PMID:21795680   PMID:21799773   PMID:21804240   PMID:21827207   PMID:21833705   PMID:21839748   PMID:21841253   PMID:21857997   PMID:21873635  
PMID:21875156   PMID:21900252   PMID:21911696   PMID:21920025   PMID:21943430   PMID:21957246   PMID:21957261   PMID:21980292   PMID:21980981   PMID:21983261   PMID:22002245   PMID:22028931  
PMID:22031292   PMID:22032174   PMID:22036844   PMID:22046086   PMID:22076653   PMID:22128151   PMID:22129783   PMID:22137330   PMID:22155634   PMID:22184125   PMID:22210626   PMID:22252492  
PMID:22285492   PMID:22293988   PMID:22318125   PMID:22356913   PMID:22363722   PMID:22384235   PMID:22411239   PMID:22484317   PMID:22505365   PMID:22511770   PMID:22558368   PMID:22561193  
PMID:22584955   PMID:22612156   PMID:22615124   PMID:22658899   PMID:22669942   PMID:22675855   PMID:22676969   PMID:22685557   PMID:22763467   PMID:22788868   PMID:22791135   PMID:22796214  
PMID:22820080   PMID:22820466   PMID:22842913   PMID:22860629   PMID:22861352   PMID:22874673   PMID:22876179   PMID:22895088   PMID:22895089   PMID:22915585   PMID:22918447   PMID:22930754  
PMID:22967749   PMID:22972305   PMID:22978166   PMID:22987042   PMID:23022479   PMID:23090399   PMID:23115236   PMID:23131565   PMID:23209282   PMID:23225001   PMID:23225009   PMID:23225390  
PMID:23236467   PMID:23256626   PMID:23276223   PMID:23283514   PMID:23319218   PMID:23324596   PMID:23376485   PMID:23386614   PMID:23392670   PMID:23398456   PMID:23399523   PMID:23405858  
PMID:23406905   PMID:23406923   PMID:23436635   PMID:23449776   PMID:23467330   PMID:23565236   PMID:23577068   PMID:23614720   PMID:23625312   PMID:23627023   PMID:23637596   PMID:23638794  
PMID:23764834   PMID:23785217   PMID:23787697   PMID:23792955   PMID:23825952   PMID:23843953   PMID:23857314   PMID:23857619   PMID:23907583   PMID:23911565   PMID:23959875   PMID:23967259  
PMID:23974118   PMID:24012003   PMID:24028865   PMID:24047819   PMID:24086135   PMID:24091711   PMID:24112521   PMID:24121542   PMID:24145555   PMID:24224623   PMID:24225951   PMID:24329154  
PMID:24338015   PMID:24360565   PMID:24390569   PMID:24398683   PMID:24493558   PMID:24498083   PMID:24519981   PMID:24606939   PMID:24620982   PMID:24623722   PMID:24706505   PMID:24714645  
PMID:24838726   PMID:24857020   PMID:24945274   PMID:24958194   PMID:24965601   PMID:24970228   PMID:25027605   PMID:25148681   PMID:25220284   PMID:25239885   PMID:25279981   PMID:25280631  
PMID:25281825   PMID:25435015   PMID:25450391   PMID:25450970   PMID:25522698   PMID:25572400   PMID:25643046   PMID:25707991   PMID:25853328   PMID:25896910   PMID:25922234   PMID:25978088  
PMID:25983001   PMID:25998112   PMID:26022925   PMID:26061765   PMID:26104335   PMID:26107283   PMID:26157118   PMID:26159734   PMID:26224839   PMID:26268049   PMID:26268531   PMID:26323476  
PMID:26368533   PMID:26528810   PMID:26667279   PMID:26683373   PMID:26710111   PMID:26778001   PMID:26836195   PMID:26864450   PMID:26871627   PMID:26878132   PMID:26946358   PMID:27056979  
PMID:27057694   PMID:27107654   PMID:27112151   PMID:27184108   PMID:27216988   PMID:27310471   PMID:27344333   PMID:27535221   PMID:27576687   PMID:27606840   PMID:27611644   PMID:27639164  
PMID:27793473   PMID:27803163   PMID:27803245   PMID:27818203   PMID:27910931   PMID:27959938   PMID:28004805   PMID:28030950   PMID:28102071   PMID:28102851   PMID:28205568   PMID:28260678  
PMID:28271922   PMID:28298427   PMID:28314738   PMID:28341739   PMID:28412969   PMID:28415023   PMID:28533442   PMID:28650319   PMID:28671123   PMID:28692055   PMID:28693923   PMID:28759037  
PMID:28795797   PMID:28800967   PMID:28838676   PMID:28900035   PMID:28901450   PMID:28931606   PMID:29107182   PMID:29127190   PMID:29141869   PMID:29180619   PMID:29382530   PMID:29393338  
PMID:29460268   PMID:29478593   PMID:29509190   PMID:29569252   PMID:29679649   PMID:29791485   PMID:30181558   PMID:30336980   PMID:30359282   PMID:30401430   PMID:30478887   PMID:30569742  
PMID:30600179   PMID:30606247   PMID:30654447   PMID:30792490   PMID:30826454   PMID:30830863   PMID:30922182   PMID:30926338   PMID:30938429   PMID:31020572   PMID:31020675   PMID:31079927  
PMID:31161647   PMID:31189938   PMID:31340582   PMID:31477838   PMID:31511544   PMID:31547531   PMID:31583788   PMID:31651418   PMID:31713950   PMID:31844149   PMID:31870551   PMID:31931179  
PMID:31980649   PMID:31989677   PMID:31991323   PMID:32001774   PMID:32098855   PMID:32284600   PMID:32321762   PMID:32458274   PMID:32502491   PMID:32514176   PMID:32560489   PMID:32612191  
PMID:32645484   PMID:32683652   PMID:32707033   PMID:32728168   PMID:32780723   PMID:32814053   PMID:32875355   PMID:32889654   PMID:32988885   PMID:33092220   PMID:33092231   PMID:33454496  
PMID:33477465   PMID:33542378   PMID:33618749   PMID:33644029   PMID:33767435   PMID:33896033   PMID:34064393   PMID:34102212   PMID:34246750   PMID:34324063   PMID:34487324   PMID:34516876  
PMID:34517052   PMID:34656326   PMID:34663460   PMID:34696491   PMID:34705895   PMID:34782343   PMID:34810220   PMID:34831353   PMID:34948096   PMID:35000151   PMID:35013218   PMID:35176965  
PMID:35387866   PMID:35696571   PMID:36037966   PMID:36088465   PMID:36138047   PMID:36213323   PMID:36215168   PMID:36499498   PMID:36543142   PMID:36744645   PMID:36843471   PMID:36879070  
PMID:36939723   PMID:37132043   PMID:37156880   PMID:37499664   PMID:37535656   PMID:37669322   PMID:37689591   PMID:37819170   PMID:37834279   PMID:38065962   PMID:38245532   PMID:38347462  
PMID:38474214   PMID:39048735   PMID:39095901   PMID:39119937   PMID:39147880   PMID:39212313   PMID:39238192   PMID:39392708   PMID:39499777   PMID:39826709  


Genomics

Comparative Map Data
PRNP
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38204,686,456 - 4,701,588 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh38.p14 Ensembl204,686,350 - 4,701,590 (+)Ensemblhg38GRCh38
GRCh37204,667,102 - 4,682,234 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36204,614,797 - 4,630,234 (+)NCBIBuild 36Build 36hg18NCBI36
Build 34204,615,068 - 4,630,233NCBI
Celera204,736,512 - 4,751,948 (+)NCBICelera
Cytogenetic Map20p13NCBI
HuRef204,620,194 - 4,635,632 (+)NCBIHuRef
CHM1_1204,667,528 - 4,682,967 (+)NCBICHM1_1
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBIT2T-CHM13v2.0
Prnp
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm392131,751,848 - 131,780,356 (+)NCBIGRCm39GRCm39mm39
GRCm39 Ensembl2131,751,848 - 131,780,349 (+)EnsemblGRCm39 EnsemblGRCm39
GRCm382131,909,928 - 131,938,436 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl2131,909,928 - 131,938,429 (+)Ensemblmm10GRCm38
MGSCv372131,735,664 - 131,764,167 (+)NCBIMGSCv37MGSCv37mm9NCBIm37
MGSCv362131,601,398 - 131,629,868 (+)NCBIMGSCv36mm8
Celera2133,143,177 - 133,164,079 (+)NCBICelera
Cytogenetic Map2F2NCBI
cM Map264.07NCBI
Prnp
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCr83139,639,076 - 139,654,420 (+)NCBIGRCr8GRCr8GRCr8
GRCr8 Ensembl3139,630,144 - 139,658,436 (+)EnsemblGRCr8
mRatBN7.23119,186,073 - 119,201,513 (+)NCBImRatBN7.2mRatBN7.2
mRatBN7.2 Ensembl3119,177,485 - 119,203,937 (+)EnsemblmRatBN7.2
UTH_Rnor_SHR_Utx3123,090,082 - 123,105,437 (+)NCBIUTH_Rnor_SHR_UtxUTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.03131,676,802 - 131,692,409 (+)NCBIUTH_Rnor_SHRSP_BbbUtx_1.0UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.03129,346,188 - 129,361,543 (+)NCBIUTH_Rnor_WKY_Bbb_1.0UTH_Rnor_WKY_Bbb_1.0
Rnor_6.03124,515,917 - 124,531,320 (+)NCBIRnor_6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl3124,515,978 - 124,531,316 (+)Ensemblrn6Rnor6.0
Rnor_5.03131,009,974 - 131,025,370 (+)NCBIRnor_5.0Rnor_5.0rn5
RGSC_v3.43119,676,137 - 119,691,507 (+)NCBIRGSC_v3.4RGSC_v3.4rn4
Celera3117,986,209 - 118,001,394 (+)NCBICelera
RGSC_v3.13119,581,709 - 119,597,080 (+)NCBI
Cytogenetic Map3q36NCBI
Prnp
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_00495541515,442,313 - 15,454,644 (+)Ensembl
ChiLan1.0NW_00495541515,442,313 - 15,454,644 (+)NCBIChiLan1.0ChiLan1.0
PRNP
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
NHGRI_mPanPan1-v2215,641,025 - 5,656,375 (+)NCBINHGRI_mPanPan1-v2
NHGRI_mPanPan1205,637,965 - 5,653,199 (+)NCBINHGRI_mPanPan1
Mhudiblu_PPA_v0204,713,616 - 4,728,847 (+)NCBIMhudiblu_PPA_v0Mhudiblu_PPA_v0panPan3
PanPan1.1204,523,141 - 4,525,522 (+)NCBIPanPan1.1PanPan1.1panPan2
PanPan1.1 Ensembl204,523,155 - 4,523,916 (+)EnsemblpanPan2panpan1.1
PRNP
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.12416,845,224 - 16,862,319 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl2416,846,207 - 16,859,815 (-)EnsemblcanFam3CanFam3.1
Dog10K_Boxer_Tasha2416,670,727 - 16,671,500 (-)NCBIDog10K_Boxer_TashaDog10K_Boxer_Tasha
ROS_Cfam_1.02417,263,379 - 17,280,460 (-)NCBIROS_Cfam_1.0ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl2417,263,381 - 17,280,378 (-)EnsemblROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.12416,859,351 - 16,860,124 (-)NCBIUMICH_Zoey_3.1
UNSW_CanFamBas_1.02416,965,836 - 16,966,609 (-)NCBIUNSW_CanFamBas_1.0
UU_Cfam_GSD_1.02417,299,279 - 17,300,052 (-)NCBIUU_Cfam_GSD_1.0UU_Cfam_GSD_1.0
Prnp
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_024408640165,673,463 - 165,687,259 (-)NCBIHiC_Itri_2
SpeTri2.0 EnsemblNW_00493648514,104,831 - 14,118,629 (-)EnsemblSpeTri2.0 Ensembl
SpeTri2.0NW_00493648514,104,829 - 14,118,614 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
PRNP
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl1713,694,190 - 13,705,124 (+)EnsemblsusScr11Sscrofa11.1
Sscrofa11.11713,694,195 - 13,705,126 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.21714,656,638 - 14,667,625 (-)NCBISscrofa10.2Sscrofa10.2susScr3
PRNP
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1233,368,020 - 33,384,556 (-)NCBIChlSab1.1ChlSab1.1chlSab2
ChlSab1.1 Ensembl233,369,629 - 33,370,366 (-)EnsemblChlSab1.1 EnsemblchlSab2Vervet-AGM
Vero_WHO_p1.0NW_02366607111,150,240 - 11,165,879 (+)NCBIVero_WHO_p1.0Vero_WHO_p1.0
Prnp
(Heterocephalus glaber - naked mole-rat)
Naked Mole-Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla_female_1.0 EnsemblNW_0046247415,785,158 - 5,802,162 (+)EnsemblHetGla_female_1.0 EnsemblhetGla2HetGla_female_1.0 Ensembl
HetGla 1.0NW_0046247415,785,139 - 5,802,162 (+)NCBIHetGla 1.0HetGla 1.0hetGla2

Variants

.
Variants in PRNP
163 total Variants

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
PRNP, ASP178ASN AND MET129 variation Fatal familial insomnia [RCV000032588] Chr20:20p13 pathogenic
NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter) single nucleotide variant CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074469] Chr20:4699655 [GRCh38]
Chr20:4680301 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.478C>T (p.Gln160Ter) single nucleotide variant CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074470]|Huntington disease-like 1 [RCV002513138] Chr20:4699698 [GRCh38]
Chr20:4680344 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.532G>A (p.Asp178Asn) single nucleotide variant Fatal familial insomnia [RCV000020248]|Gerstmann-Straussler-Scheinker syndrome [RCV005252115]|Huntington disease-like 1 [RCV001214652]|not provided [RCV001200144] Chr20:4699752 [GRCh38]
Chr20:4680398 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic|not provided
NM_000311.5(PRNP):c.154_177[6_13] microsatellite Gerstmann-Straussler-Scheinker syndrome [RCV000014327]|Huntington disease-like 1 [RCV000014328]|Inherited Creutzfeldt-Jakob disease [RCV000014326]|Inherited prion disease [RCV000020259] Chr20:4699379..4699380 [GRCh38]
Chr20:4680026..4680049 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.305C>T (p.Pro102Leu) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014329]|Huntington disease-like 1 [RCV001203438]|Inherited Creutzfeldt-Jakob disease [RCV001813741]|Spongiform encephalopathy with neuropsychiatric features [RCV001642224]|not provided [RCV001269667] Chr20:4699525 [GRCh38]
Chr20:4680171 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.350C>T (p.Ala117Val) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014330]|Inborn genetic diseases [RCV000623716]|not provided [RCV005089252] Chr20:4699570 [GRCh38]
Chr20:4680216 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.385A>G (p.Met129Val) single nucleotide variant Alzheimer disease, early-onset, susceptibility to [RCV000014332]|Aphasia, primary progressive, susceptibility to [RCV000014333]|Autism spectrum disorder [RCV003313921]|Fatal familial insomnia [RCV003450639]|Huntington disease-like 1 [RCV000990275]|Inherited Creutzfeldt-Jakob disease [RCV001262968]|Inherited Creutzfeldt-Jakob disease [RCV002490365]|Inherited prion disease [RCV000020244]|Prion disease, susceptibility to [RCV000014331]|not provided [RCV001723566]|not specified [RCV000118064] Chr20:4699605 [GRCh38]
Chr20:4680251 [GRCh37]
Chr20:20p13		 risk factor|likely risk allele|benign|likely benign|uncertain significance
NM_000311.5(PRNP):c.598G>A (p.Glu200Lys) single nucleotide variant Fatal familial insomnia [RCV000014335]|Huntington disease-like 1 [RCV000644587]|Inherited Creutzfeldt-Jakob disease [RCV000014334]|Inherited Creutzfeldt-Jakob disease [RCV005025054]|not provided [RCV001310451] Chr20:4699818 [GRCh38]
Chr20:4680464 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.593T>C (p.Phe198Ser) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014340]|Huntington disease-like 1 [RCV000644586]|not provided [RCV001551488] Chr20:4699813 [GRCh38]
Chr20:4680459 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.650A>G (p.Gln217Arg) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014341]|Huntington disease-like 1 [RCV001851852]|PRNP-related disorder [RCV003987321] Chr20:4699870 [GRCh38]
Chr20:4680516 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic
NM_000311.5(PRNP):c.628G>A (p.Val210Ile) single nucleotide variant Huntington disease-like 1 [RCV000532969]|Inborn genetic diseases [RCV004018625]|Inherited Creutzfeldt-Jakob disease [RCV000014342]|Inherited Creutzfeldt-Jakob disease [RCV002476962] Chr20:4699848 [GRCh38]
Chr20:4680494 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic|low penetrance
NM_000311.5(PRNP):c.314C>T (p.Pro105Leu) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014343]|Inborn genetic diseases [RCV000190750] Chr20:4699534 [GRCh38]
Chr20:4680180 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.538G>A (p.Val180Ile) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV001807726]|Huntington disease-like 1 [RCV001212635]|Inherited Creutzfeldt-Jakob disease [RCV000014344]|Inherited Creutzfeldt-Jakob disease [RCV002476963]|Inherited prion disease [RCV000020249] Chr20:4699758 [GRCh38]
Chr20:4680404 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|low penetrance
NM_000311.5(PRNP):c.695T>G (p.Met232Arg) single nucleotide variant Huntington disease-like 1 [RCV000990277]|Inherited Creutzfeldt-Jakob disease [RCV000014345]|Inherited Creutzfeldt-Jakob disease [RCV002496357] Chr20:4699915 [GRCh38]
Chr20:4680561 [GRCh37]
Chr20:20p13		 pathogenic|uncertain significance
NM_000311.5(PRNP):c.547A>G (p.Thr183Ala) single nucleotide variant Huntington disease-like 1 [RCV003514300]|Spongiform encephalopathy with neuropsychiatric features [RCV000014347] Chr20:4699767 [GRCh38]
Chr20:4680413 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.512A>G (p.Asn171Ser) single nucleotide variant Huntington disease-like 1 [RCV000644585]|Inherited prion disease [RCV000020247]|Spongiform encephalopathy with neuropsychiatric features [RCV000014348]|not provided [RCV001580052]|not specified [RCV001725931] Chr20:4699732 [GRCh38]
Chr20:4680378 [GRCh37]
Chr20:20p13		 benign|likely benign|uncertain significance
NM_000311.5(PRNP):c.655G>A (p.Glu219Lys) single nucleotide variant Huntington disease-like 1 [RCV000873683]|Inherited prion disease [RCV000020257]|Reclassified - variant of unknown significance [RCV004577713]|not provided [RCV001573203] Chr20:4699875 [GRCh38]
Chr20:4680521 [GRCh37]
Chr20:20p13		 benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance
NM_000311.5(PRNP):c.392G>T (p.Gly131Val) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014351]|Huntington disease-like 1 [RCV001348311] Chr20:4699612 [GRCh38]
Chr20:4680258 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic|uncertain significance
NM_000311.5(PRNP):c.623G>A (p.Arg208His) single nucleotide variant Huntington disease-like 1 [RCV001851853]|Inherited Creutzfeldt-Jakob disease [RCV000014352]|PRNP-related disorder [RCV002468968]|not provided [RCV001823096] Chr20:4699843 [GRCh38]
Chr20:4680489 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic|uncertain significance
NM_000311.5(PRNP):c.560A>G (p.His187Arg) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014353]|Spongiform encephalopathy with neuropsychiatric features [RCV000014354] Chr20:4699780 [GRCh38]
Chr20:4680426 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.313C>A (p.Pro105Thr) single nucleotide variant Spongiform encephalopathy with neuropsychiatric features [RCV000014355] Chr20:4699533 [GRCh38]
Chr20:4680179 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.398C>T (p.Ala133Val) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014356] Chr20:4699618 [GRCh38]
Chr20:4680264 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.313C>T (p.Pro105Ser) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000014357]|not provided [RCV003319302] Chr20:4699533 [GRCh38]
Chr20:4680179 [GRCh37]
Chr20:20p13		 pathogenic|uncertain significance
NM_000311.5(PRNP):c.380G>T (p.Gly127Val) single nucleotide variant Kuru, protection against [RCV000014358] Chr20:4699600 [GRCh38]
Chr20:4680246 [GRCh37]
Chr20:20p13		 protective
NM_000311.5(PRNP):c.180T>C (p.Pro60=) single nucleotide variant Spongiform encephalopathy with neuropsychiatric features [RCV000549562] Chr20:4699400 [GRCh38]
Chr20:4680046 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del) microsatellite Huntington disease-like 1 [RCV000644588]|Inherited Creutzfeldt-Jakob disease [RCV002490633]|Inherited prion disease [RCV000055681]|not provided [RCV001560143] Chr20:4699380..4699403 [GRCh38]
Chr20:4680026..4680049 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.631G>C (p.Glu211Gln) single nucleotide variant Inherited Creutzfeldt-Jakob disease [RCV000074468] Chr20:4699851 [GRCh38]
Chr20:4680497 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.679C>T (p.Gln227Ter) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000074472] Chr20:4699899 [GRCh38]
Chr20:4680545 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.489C>G (p.Tyr163Ter) single nucleotide variant CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074473] Chr20:4699709 [GRCh38]
Chr20:4680355 [GRCh37]
Chr20:20p13		 pathogenic
GRCh38/hg38 20p13-11.21(chr20:89939-25697564)x3 copy number gain See cases [RCV000051227] Chr20:89939..25697564 [GRCh38]
Chr20:70580..25678200 [GRCh37]
Chr20:18580..25626200 [NCBI36]
Chr20:20p13-11.21		 pathogenic
GRCh38/hg38 20p13-11.23(chr20:89939-19146279)x3 copy number gain See cases [RCV000051041] Chr20:89939..19146279 [GRCh38]
Chr20:70580..19126923 [GRCh37]
Chr20:18580..19074923 [NCBI36]
Chr20:20p13-11.23		 pathogenic
GRCh38/hg38 20p13-11.23(chr20:89939-19071495)x3 copy number gain See cases [RCV000052995] Chr20:89939..19071495 [GRCh38]
Chr20:70580..19052139 [GRCh37]
Chr20:18580..19000139 [NCBI36]
Chr20:20p13-11.23		 pathogenic
GRCh38/hg38 20p13-11.22(chr20:89939-21787252)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052996]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052996]|See cases [RCV000052996] Chr20:89939..21787252 [GRCh38]
Chr20:70580..21767890 [GRCh37]
Chr20:18580..21715890 [NCBI36]
Chr20:20p13-11.22		 pathogenic
GRCh38/hg38 20p13-12.1(chr20:89939-14818511)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052997]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052997]|See cases [RCV000052997] Chr20:89939..14818511 [GRCh38]
Chr20:70580..14799157 [GRCh37]
Chr20:18580..14747157 [NCBI36]
Chr20:20p13-12.1		 pathogenic
NM_000311.5(PRNP):c.633G>C (p.Glu211Asp) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV000074467]|Huntington disease-like 1 [RCV001854271] Chr20:4699853 [GRCh38]
Chr20:4680499 [GRCh37]
Chr20:20p13		 pathogenic|uncertain significance
NM_000311.5(PRNP):c.678C>A (p.Tyr226Ter) single nucleotide variant CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED [RCV000074471]|not provided [RCV002054924] Chr20:4699898 [GRCh38]
Chr20:4680544 [GRCh37]
Chr20:20p13		 pathogenic|likely pathogenic
GRCh38/hg38 20p13-q11.1(chr20:80106-30227427)x3 copy number gain See cases [RCV000133996] Chr20:80106..30227427 [GRCh38]
Chr20:60747..29462103 [GRCh37]
Chr20:8747..28075764 [NCBI36]
Chr20:20p13-q11.1		 pathogenic
GRCh38/hg38 20p13-q13.33(chr20:99557-64277321)x3 copy number gain See cases [RCV000135859] Chr20:99557..64277321 [GRCh38]
Chr20:80198..62908674 [GRCh37]
Chr20:28198..62379118 [NCBI36]
Chr20:20p13-q13.33		 pathogenic
GRCh38/hg38 20p13(chr20:4594991-5050271)x3 copy number gain See cases [RCV000135607] Chr20:4594991..5050271 [GRCh38]
Chr20:4575637..5030917 [GRCh37]
Chr20:4523637..4978917 [NCBI36]
Chr20:20p13		 uncertain significance
GRCh38/hg38 20p13-12.3(chr20:4343033-6911730)x1 copy number loss See cases [RCV000137695] Chr20:4343033..6911730 [GRCh38]
Chr20:4323680..6892377 [GRCh37]
Chr20:4271680..6840377 [NCBI36]
Chr20:20p13-12.3		 pathogenic
NM_000311.5(PRNP):c.228C>T (p.Pro76=) single nucleotide variant Huntington disease-like 1 [RCV000644590]|Inherited prion disease [RCV000283524]|not provided [RCV004703470]|not specified [RCV000202898] Chr20:4699448 [GRCh38]
Chr20:4680094 [GRCh37]
Chr20:20p13		 benign|likely benign
GRCh38/hg38 20p13-12.1(chr20:80106-13029401)x3 copy number gain See cases [RCV000138677] Chr20:80106..13029401 [GRCh38]
Chr20:60747..13010049 [GRCh37]
Chr20:8747..12958049 [NCBI36]
Chr20:20p13-12.1		 pathogenic
GRCh38/hg38 20p13-12.3(chr20:80093-6386012)x3 copy number gain See cases [RCV000139597] Chr20:80093..6386012 [GRCh38]
Chr20:60734..6366659 [GRCh37]
Chr20:8734..6314659 [NCBI36]
Chr20:20p13-12.3		 pathogenic
GRCh38/hg38 20p13-12.3(chr20:84402-6159078)x3 copy number gain See cases [RCV000141348] Chr20:84402..6159078 [GRCh38]
Chr20:65043..6139725 [GRCh37]
Chr20:13043..6087725 [NCBI36]
Chr20:20p13-12.3		 pathogenic
GRCh38/hg38 20p13-11.1(chr20:80927-26324843)x3 copy number gain See cases [RCV000142017] Chr20:80927..26324843 [GRCh38]
Chr20:61568..26305479 [GRCh37]
Chr20:9568..26253479 [NCBI36]
Chr20:20p13-11.1		 pathogenic
GRCh38/hg38 20p13-12.3(chr20:80927-5447679)x3 copy number gain See cases [RCV000142285] Chr20:80927..5447679 [GRCh38]
Chr20:61568..5428325 [GRCh37]
Chr20:9568..5376325 [NCBI36]
Chr20:20p13-12.3		 uncertain significance
GRCh38/hg38 20p13-12.3(chr20:1269303-8626911)x3 copy number gain See cases [RCV000142917] Chr20:1269303..8626911 [GRCh38]
Chr20:1249947..8607558 [GRCh37]
Chr20:1197947..8555558 [NCBI36]
Chr20:20p13-12.3		 pathogenic
GRCh38/hg38 20p13-11.23(chr20:80928-18688031)x3 copy number gain See cases [RCV000143426] Chr20:80928..18688031 [GRCh38]
Chr20:61569..18668675 [GRCh37]
Chr20:9569..18616675 [NCBI36]
Chr20:20p13-11.23		 pathogenic
NM_000311.5(PRNP):c.635A>C (p.Gln212Pro) single nucleotide variant Fatal familial insomnia [RCV001786518]|Gerstmann-Straussler-Scheinker syndrome [RCV003994328]|Huntington disease-like 1 [RCV002034620] Chr20:4699855 [GRCh38]
Chr20:4680501 [GRCh37]
Chr20:20p13		 likely pathogenic|uncertain significance
GRCh37/hg19 20p13-12.3(chr20:121521-5564937)x3 copy number gain See cases [RCV000239772] Chr20:121521..5564937 [GRCh37]
Chr20:20p13-12.3		 pathogenic
GRCh37/hg19 20p13-11.1(chr20:80198-26075841)x3 copy number gain See cases [RCV000239954] Chr20:80198..26075841 [GRCh37]
Chr20:20p13-11.1		 pathogenic
NM_000311.5(PRNP):c.*1412T>A single nucleotide variant Inherited prion disease [RCV000308027] Chr20:4701394 [GRCh38]
Chr20:4682040 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.4(PRNP):c.-310T>A single nucleotide variant Inherited prion disease [RCV000354483] Chr20:4686213 [GRCh38]
Chr20:4666859 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*216G>A single nucleotide variant Inherited prion disease [RCV000272162] Chr20:4700198 [GRCh38]
Chr20:4680844 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*4A>T single nucleotide variant Inherited prion disease [RCV000313042]|not provided [RCV001653637] Chr20:4699986 [GRCh38]
Chr20:4680632 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*206A>G single nucleotide variant Inherited prion disease [RCV000364388]|not provided [RCV001653638] Chr20:4700188 [GRCh38]
Chr20:4680834 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*697A>G single nucleotide variant Inherited prion disease [RCV000279025]|not provided [RCV004718533] Chr20:4700679 [GRCh38]
Chr20:4681325 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*70G>A single nucleotide variant Inherited prion disease [RCV000369995]|not provided [RCV001584043] Chr20:4700052 [GRCh38]
Chr20:4680698 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*1588C>T single nucleotide variant Inherited prion disease [RCV000272914] Chr20:4701570 [GRCh38]
Chr20:4682216 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*936C>T single nucleotide variant Inherited prion disease [RCV000282495] Chr20:4700918 [GRCh38]
Chr20:4681564 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*672C>G single nucleotide variant Inherited prion disease [RCV000322658] Chr20:4700654 [GRCh38]
Chr20:4681300 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*592T>C single nucleotide variant Inherited prion disease [RCV000283945] Chr20:4700574 [GRCh38]
Chr20:4681220 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*115G>A single nucleotide variant Inherited Creutzfeldt-Jakob disease [RCV002487496]|Inherited prion disease [RCV000325989]|not provided [RCV004694609] Chr20:4700097 [GRCh38]
Chr20:4680743 [GRCh37]
Chr20:20p13		 likely benign|uncertain significance
NM_000311.5(PRNP):c.-22C>G single nucleotide variant Inherited prion disease [RCV000274590] Chr20:4686501 [GRCh38]
Chr20:4667147 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.351A>G (p.Ala117=) single nucleotide variant Huntington disease-like 1 [RCV000539354]|Inherited prion disease [RCV000287089]|not provided [RCV001712126]|not specified [RCV001579381] Chr20:4699571 [GRCh38]
Chr20:4680217 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.160G>A (p.Gly54Ser) single nucleotide variant Huntington disease-like 1 [RCV000527040]|Inherited prion disease [RCV000326386]|not provided [RCV004597783] Chr20:4699380 [GRCh38]
Chr20:4680026 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*682A>G single nucleotide variant Inherited prion disease [RCV000379630]|not provided [RCV001709609] Chr20:4700664 [GRCh38]
Chr20:4681310 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.159C>T (p.Gly53=) single nucleotide variant Huntington disease-like 1 [RCV000958397]|Inherited Creutzfeldt-Jakob disease [RCV002504142]|Inherited prion disease [RCV000287805]|not provided [RCV004703828] Chr20:4699379 [GRCh38]
Chr20:4680025 [GRCh37]
Chr20:20p13		 benign|likely benign|uncertain significance
NM_000311.5(PRNP):c.204T>C (p.Pro68=) single nucleotide variant Huntington disease-like 1 [RCV000874283]|Inherited prion disease [RCV000383267]|not provided [RCV001580001] Chr20:4699424 [GRCh38]
Chr20:4680070 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*800C>T single nucleotide variant Inherited prion disease [RCV000336389] Chr20:4700782 [GRCh38]
Chr20:4681428 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.372C>G (p.Gly124=) single nucleotide variant Huntington disease-like 1 [RCV000873874]|Inherited prion disease [RCV000334919]|not provided [RCV001580108] Chr20:4699592 [GRCh38]
Chr20:4680238 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.246A>G (p.Gly82=) single nucleotide variant Huntington disease-like 1 [RCV000644591]|Inherited prion disease [RCV000340924]|not provided [RCV004717391] Chr20:4699466 [GRCh38]
Chr20:4680112 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.*1281A>G single nucleotide variant Inherited prion disease [RCV000396883] Chr20:4701263 [GRCh38]
Chr20:4681909 [GRCh37]
Chr20:20p13		 likely benign|uncertain significance
NM_000311.5(PRNP):c.*98TCT[1] microsatellite Inherited prion disease [RCV000277802] Chr20:4700079..4700081 [GRCh38]
Chr20:4680725..4680727 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.*1063G>A single nucleotide variant Inherited prion disease [RCV000314101] Chr20:4701045 [GRCh38]
Chr20:4681691 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.4(PRNP):c.-245C>G single nucleotide variant Inherited prion disease [RCV000262092]|not provided [RCV004717390] Chr20:4686278 [GRCh38]
Chr20:4666924 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.252T>C (p.Pro84=) single nucleotide variant Inherited prion disease [RCV000398037]|not provided [RCV004717392] Chr20:4699472 [GRCh38]
Chr20:4680118 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.424G>A (p.Gly142Ser) single nucleotide variant Huntington disease-like 1 [RCV000990276]|Inherited prion disease [RCV000299881]|not provided [RCV003736731] Chr20:4699644 [GRCh38]
Chr20:4680290 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.*874C>T single nucleotide variant Inherited prion disease [RCV000402484] Chr20:4700856 [GRCh38]
Chr20:4681502 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.-18C>T single nucleotide variant Inherited prion disease [RCV000388958] Chr20:4686505 [GRCh38]
Chr20:4667151 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.78G>A (p.Pro26=) single nucleotide variant not provided [RCV003312534] Chr20:4699298 [GRCh38]
Chr20:4679944 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.*358C>A single nucleotide variant Inherited prion disease [RCV000329503] Chr20:4700340 [GRCh38]
Chr20:4680986 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.-21G>T single nucleotide variant Inherited prion disease [RCV000332043] Chr20:4686502 [GRCh38]
Chr20:4667148 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*1466G>C single nucleotide variant Inherited prion disease [RCV000365069] Chr20:4701448 [GRCh38]
Chr20:4682094 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*994C>T single nucleotide variant Inherited prion disease [RCV000349067] Chr20:4700976 [GRCh38]
Chr20:4681622 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.4(PRNP):c.-206C>G single nucleotide variant Inherited prion disease [RCV000366752] Chr20:4686317 [GRCh38]
Chr20:4666963 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.4(PRNP):c.-211G>A single nucleotide variant Inherited prion disease [RCV000319119] Chr20:4686312 [GRCh38]
Chr20:4666958 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*1193G>A single nucleotide variant Inherited prion disease [RCV000352526] Chr20:4701175 [GRCh38]
Chr20:4681821 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*407T>G single nucleotide variant Inherited prion disease [RCV000376080] Chr20:4700389 [GRCh38]
Chr20:4681035 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*1035T>G single nucleotide variant Inherited prion disease [RCV000396906] Chr20:4701017 [GRCh38]
Chr20:4681663 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.497T>C (p.Met166Thr) single nucleotide variant Inherited prion disease [RCV001139175] Chr20:4699717 [GRCh38]
Chr20:4680363 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.415A>G (p.Ile139Val) single nucleotide variant not provided [RCV000522930] Chr20:4699635 [GRCh38]
Chr20:4680281 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13(chr20:61568-4914872)x3 copy number gain See cases [RCV000446883] Chr20:61568..4914872 [GRCh37]
Chr20:20p13		 pathogenic
GRCh37/hg19 20p13-12.1(chr20:4392930-12667768)x1 copy number loss See cases [RCV000446718] Chr20:4392930..12667768 [GRCh37]
Chr20:20p13-12.1		 pathogenic
GRCh37/hg19 20p13(chr20:61568-4904599)x3 copy number gain See cases [RCV000448397] Chr20:61568..4904599 [GRCh37]
Chr20:20p13		 pathogenic
GRCh37/hg19 20p13-q11.21(chr20:80198-26208081)x3 copy number gain not provided [RCV000487461] Chr20:80198..26208081 [GRCh37]
Chr20:20p13-q11.21		 pathogenic
GRCh37/hg19 20p13-12.3(chr20:213423-5483406)x3 copy number gain See cases [RCV000510531] Chr20:213423..5483406 [GRCh37]
Chr20:20p13-12.3		 uncertain significance
GRCh37/hg19 20p13-12.3(chr20:2463101-8185680)x1 copy number loss See cases [RCV000511897] Chr20:2463101..8185680 [GRCh37]
Chr20:20p13-12.3		 pathogenic
GRCh37/hg19 20p13-q13.33(chr20:61569-62915555)x3 copy number gain See cases [RCV000510832] Chr20:61569..62915555 [GRCh37]
Chr20:20p13-q13.33		 pathogenic
NM_000311.5(PRNP):c.246_269del (p.60_67PHGGGWGQ[3]) deletion Huntington disease-like 1 [RCV000990274]|not provided [RCV001706695] Chr20:4699449..4699472 [GRCh38]
Chr20:4680095..4680118 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.198G>A (p.Gly66=) single nucleotide variant Spongiform encephalopathy with neuropsychiatric features [RCV000536485] Chr20:4699418 [GRCh38]
Chr20:4680064 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13-q13.33(chr20:61569-62915555) copy number gain See cases [RCV000512450] Chr20:61569..62915555 [GRCh37]
Chr20:20p13-q13.33		 pathogenic
GRCh37/hg19 20p13-12.2(chr20:61568-10486106)x3 copy number gain See cases [RCV000512556] Chr20:61568..10486106 [GRCh37]
Chr20:20p13-12.2		 likely pathogenic
GRCh37/hg19 20p13-12.1(chr20:3092739-17091453)x1 copy number loss not provided [RCV000684134] Chr20:3092739..17091453 [GRCh37]
Chr20:20p13-12.1		 pathogenic
NM_000311.5(PRNP):c.462G>A (p.Met154Ile) single nucleotide variant Huntington disease-like 1 [RCV000690098] Chr20:4699682 [GRCh38]
Chr20:4680328 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13-q13.33(chr20:63244-62948788)x3 copy number gain not provided [RCV000741058] Chr20:63244..62948788 [GRCh37]
Chr20:20p13-q13.33		 pathogenic
GRCh37/hg19 20p13-q13.33(chr20:63244-62961294)x3 copy number gain not provided [RCV000741059] Chr20:63244..62961294 [GRCh37]
Chr20:20p13-q13.33		 pathogenic
GRCh37/hg19 20p13-q13.33(chr20:63244-62912463)x3 copy number gain not provided [RCV000741057] Chr20:63244..62912463 [GRCh37]
Chr20:20p13-q13.33		 pathogenic
NM_000311.5(PRNP):c.306G>A (p.Pro102=) single nucleotide variant Huntington disease-like 1 [RCV000945465]|Inherited Creutzfeldt-Jakob disease [RCV002489280]|not provided [RCV001811543] Chr20:4699526 [GRCh38]
Chr20:4680172 [GRCh37]
Chr20:20p13		 benign|likely benign
NM_000311.5(PRNP):c.366G>T (p.Val122=) single nucleotide variant Huntington disease-like 1 [RCV002542239] Chr20:4699586 [GRCh38]
Chr20:4680232 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.624C>T (p.Arg208=) single nucleotide variant Huntington disease-like 1 [RCV002064803] Chr20:4699844 [GRCh38]
Chr20:4680490 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.700C>T (p.Leu234Phe) single nucleotide variant Huntington disease-like 1 [RCV002539998] Chr20:4699920 [GRCh38]
Chr20:4680566 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.50G>C (p.Ser17Thr) single nucleotide variant Huntington disease-like 1 [RCV003626668]|not provided [RCV001091285] Chr20:4699270 [GRCh38]
Chr20:4679916 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) microsatellite PRNP-associated condition [RCV000850408] Chr20:4699379..4699380 [GRCh38]
Chr20:4680025..4680026 [GRCh37]
Chr20:20p13		 pathogenic
NC_000020.11:g.4701861C>T single nucleotide variant not provided [RCV001620377] Chr20:4701861 [GRCh38]
Chr20:4682507 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.519C>T (p.Asn173=) single nucleotide variant Huntington disease-like 1 [RCV000945928] Chr20:4699739 [GRCh38]
Chr20:4680385 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.565G>A (p.Val189Ile) single nucleotide variant Inherited prion disease [RCV001139176]|not provided [RCV004720768]|not specified [RCV003117783] Chr20:4699785 [GRCh38]
Chr20:4680431 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.5C>T (p.Ala2Val) single nucleotide variant Huntington disease-like 1 [RCV001858941]|Inherited prion disease [RCV001143500] Chr20:4699225 [GRCh38]
Chr20:4679871 [GRCh37]
Chr20:20p13		 likely benign|uncertain significance
NM_000311.5(PRNP):c.661G>A (p.Glu221Lys) single nucleotide variant not provided [RCV003231659] Chr20:4699881 [GRCh38]
Chr20:4680527 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13-11.1(chr20:61568-26305479)x3 copy number gain not provided [RCV001007068] Chr20:61568..26305479 [GRCh37]
Chr20:20p13-11.1		 pathogenic
NM_000311.5(PRNP):c.325A>T (p.Met109Leu) single nucleotide variant Huntington disease-like 1 [RCV005105144]|not provided [RCV004801556] Chr20:4699545 [GRCh38]
Chr20:4680191 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.-10-21G>A single nucleotide variant not provided [RCV001639102] Chr20:4699190 [GRCh38]
Chr20:4679836 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.*460G>T single nucleotide variant Inherited prion disease [RCV001141798] Chr20:4700442 [GRCh38]
Chr20:4681088 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.116C>T (p.Pro39Leu) single nucleotide variant Huntington disease-like 1 [RCV001361599]|Inherited prion disease [RCV001143502] Chr20:4699336 [GRCh38]
Chr20:4679982 [GRCh37]
Chr20:20p13		 benign|uncertain significance
GRCh37/hg19 20p13(chr20:4439086-4676435)x3 copy number gain not provided [RCV001007075] Chr20:4439086..4676435 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.76C>G (p.Pro26Ala) single nucleotide variant Inherited prion disease [RCV001143501] Chr20:4699296 [GRCh38]
Chr20:4679942 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*482A>G single nucleotide variant Inherited prion disease [RCV001143601] Chr20:4700464 [GRCh38]
Chr20:4681110 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.654C>T (p.Tyr218=) single nucleotide variant Huntington disease-like 1 [RCV002070645]|Inherited prion disease [RCV001139177]|not provided [RCV003433025] Chr20:4699874 [GRCh38]
Chr20:4680520 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.606C>T (p.Asp202=) single nucleotide variant Huntington disease-like 1 [RCV002069605]|not provided [RCV001091286] Chr20:4699826 [GRCh38]
Chr20:4680472 [GRCh37]
Chr20:20p13		 likely benign|uncertain significance
NM_000311.5(PRNP):c.*1134T>A single nucleotide variant Inherited prion disease [RCV001137030] Chr20:4701116 [GRCh38]
Chr20:4681762 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.*1328T>C single nucleotide variant Inherited prion disease [RCV001137031] Chr20:4701310 [GRCh38]
Chr20:4681956 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.180_227del (p.60_67PHGGGWGQ[2]) deletion Huntington disease-like 1 [RCV001064781] Chr20:4699380..4699427 [GRCh38]
Chr20:4680026..4680073 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.143G>A (p.Arg48His) single nucleotide variant Huntington disease-like 1 [RCV005093605]|Inherited prion disease [RCV001136928]|not provided [RCV001811670] Chr20:4699363 [GRCh38]
Chr20:4680009 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13(chr20:3092739-4939933)x3 copy number gain not provided [RCV001258903] Chr20:3092739..4939933 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.290G>A (p.Ser97Asn) single nucleotide variant Huntington disease-like 1 [RCV001302191]|not specified [RCV002246290] Chr20:4699510 [GRCh38]
Chr20:4680156 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.414C>G (p.Ile138Met) single nucleotide variant not specified [RCV002248131] Chr20:4699634 [GRCh38]
Chr20:4680280 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.467G>A (p.Arg156His) single nucleotide variant not provided [RCV001768366] Chr20:4699687 [GRCh38]
Chr20:4680333 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.483G>A (p.Val161=) single nucleotide variant not provided [RCV001816303] Chr20:4699703 [GRCh38]
Chr20:4680349 [GRCh37]
Chr20:20p13		 likely benign
GRCh37/hg19 20p13-12.2(chr20:3178539-11848383) copy number loss 20p12.3 microdeletion syndrome [RCV002280726] Chr20:3178539..11848383 [GRCh37]
Chr20:20p13-12.2		 pathogenic
NM_000311.5(PRNP):c.392G>A (p.Gly131Glu) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV001809309] Chr20:4699612 [GRCh38]
Chr20:4680258 [GRCh37]
Chr20:20p13		 likely pathogenic
NM_000311.5(PRNP):c.452G>T (p.Arg151Leu) single nucleotide variant Huntington disease-like 1 [RCV001915256]|Inborn genetic diseases [RCV004955766]|not provided [RCV003130585] Chr20:4699672 [GRCh38]
Chr20:4680318 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.408G>T (p.Arg136Ser) single nucleotide variant Huntington disease-like 1 [RCV002025659] Chr20:4699628 [GRCh38]
Chr20:4680274 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.625G>A (p.Val209Met) single nucleotide variant Huntington disease-like 1 [RCV001913502] Chr20:4699845 [GRCh38]
Chr20:4680491 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.498G>A (p.Met166Ile) single nucleotide variant Huntington disease-like 1 [RCV001968814]|Inherited Creutzfeldt-Jakob disease [RCV002479611] Chr20:4699718 [GRCh38]
Chr20:4680364 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.620A>G (p.Glu207Gly) single nucleotide variant Huntington disease-like 1 [RCV001945632] Chr20:4699840 [GRCh38]
Chr20:4680486 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.713C>T (p.Pro238Leu) single nucleotide variant Vascular dementia [RCV002051771] Chr20:4699933 [GRCh38]
Chr20:4680579 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.86G>A (p.Gly29Glu) single nucleotide variant Huntington disease-like 1 [RCV001991499] Chr20:4699306 [GRCh38]
Chr20:4679952 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.622C>T (p.Arg208Cys) single nucleotide variant Huntington disease-like 1 [RCV001916110] Chr20:4699842 [GRCh38]
Chr20:4680488 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.755T>C (p.Val252Ala) single nucleotide variant Huntington disease-like 1 [RCV001973743] Chr20:4699975 [GRCh38]
Chr20:4680621 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.493C>T (p.Pro165Ser) single nucleotide variant Huntington disease-like 1 [RCV002019709] Chr20:4699713 [GRCh38]
Chr20:4680359 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.407G>C (p.Arg136Thr) single nucleotide variant Huntington disease-like 1 [RCV002014156] Chr20:4699627 [GRCh38]
Chr20:4680273 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.443G>A (p.Arg148His) single nucleotide variant Huntington disease-like 1 [RCV002009625]|Inherited Creutzfeldt-Jakob disease [RCV003324843] Chr20:4699663 [GRCh38]
Chr20:4680309 [GRCh37]
Chr20:20p13		 likely pathogenic
NM_000311.5(PRNP):c.222_245del (p.60PHGGGWGQ[3]) deletion Huntington disease-like 1 [RCV002019177]|not specified [RCV003388076] Chr20:4699425..4699448 [GRCh38]
Chr20:4680071..4680094 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.384_385inv (p.Met129Val) inversion Huntington disease-like 1 [RCV002204940] Chr20:4699604..4699605 [GRCh38]
Chr20:4680250..4680251 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.603C>T (p.Thr201=) single nucleotide variant Huntington disease-like 1 [RCV002092386] Chr20:4699823 [GRCh38]
Chr20:4680469 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.117G>A (p.Pro39=) single nucleotide variant Huntington disease-like 1 [RCV002187888] Chr20:4699337 [GRCh38]
Chr20:4679983 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.507C>T (p.Tyr169=) single nucleotide variant Huntington disease-like 1 [RCV002085366] Chr20:4699727 [GRCh38]
Chr20:4680373 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.531C>T (p.His177=) single nucleotide variant Huntington disease-like 1 [RCV002215323]|Inborn genetic diseases [RCV003375573] Chr20:4699751 [GRCh38]
Chr20:4680397 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.408G>A (p.Arg136=) single nucleotide variant Huntington disease-like 1 [RCV002105659] Chr20:4699628 [GRCh38]
Chr20:4680274 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.636G>A (p.Gln212=) single nucleotide variant Huntington disease-like 1 [RCV002078334]|Inherited Creutzfeldt-Jakob disease [RCV002498286] Chr20:4699856 [GRCh38]
Chr20:4680502 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.228_251del (p.60PHGGGWGQ[3]) deletion Huntington disease-like 1 [RCV002076280]|not provided [RCV003883778] Chr20:4699443..4699466 [GRCh38]
Chr20:4680089..4680112 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.225G>A (p.Gln75=) single nucleotide variant Huntington disease-like 1 [RCV002139675]|not provided [RCV004704760] Chr20:4699445 [GRCh38]
Chr20:4680091 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.591C>T (p.Asn197=) single nucleotide variant Huntington disease-like 1 [RCV002219413] Chr20:4699811 [GRCh38]
Chr20:4680457 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.333C>T (p.His111=) single nucleotide variant Huntington disease-like 1 [RCV002162411] Chr20:4699553 [GRCh38]
Chr20:4680199 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.537C>T (p.Cys179=) single nucleotide variant Huntington disease-like 1 [RCV002219087] Chr20:4699757 [GRCh38]
Chr20:4680403 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.57G>A (p.Leu19=) single nucleotide variant Huntington disease-like 1 [RCV002137583] Chr20:4699277 [GRCh38]
Chr20:4679923 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.714_716del (p.Pro239del) deletion not specified [RCV002222914] Chr20:4699932..4699934 [GRCh38]
Chr20:4680578..4680580 [GRCh37]
Chr20:20p13		 uncertain significance
NC_000020.10:g.(?_1959939)_(6760201_?)dup duplication Huntington disease-like 1 [RCV003110989]|Pigmentary pallidal degeneration [RCV003122285] Chr20:1959939..6760201 [GRCh37]
Chr20:20p13-12.3		 uncertain significance
NM_000311.5(PRNP):c.546C>G (p.Ile182Met) single nucleotide variant Huntington disease-like 1 [RCV003115276] Chr20:4699766 [GRCh38]
Chr20:4680412 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.284C>A (p.Thr95Asn) single nucleotide variant not provided [RCV004776811] Chr20:4699504 [GRCh38]
Chr20:4680150 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.696G>T (p.Met232Ile) single nucleotide variant not provided [RCV002287003] Chr20:4699916 [GRCh38]
Chr20:4680562 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.473C>T (p.Pro158Leu) single nucleotide variant not provided [RCV002283037] Chr20:4699693 [GRCh38]
Chr20:4680339 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.206A>T (p.His69Leu) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV002283861] Chr20:4699426 [GRCh38]
Chr20:4680072 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.278G>A (p.Gly93Asp) single nucleotide variant Huntington disease-like 1 [RCV002302379] Chr20:4699498 [GRCh38]
Chr20:4680144 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.6G>A (p.Ala2=) single nucleotide variant Huntington disease-like 1 [RCV002816171] Chr20:4699226 [GRCh38]
Chr20:4679872 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.452G>A (p.Arg151His) single nucleotide variant Huntington disease-like 1 [RCV002995595] Chr20:4699672 [GRCh38]
Chr20:4680318 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.564G>A (p.Thr188=) single nucleotide variant Huntington disease-like 1 [RCV002614387] Chr20:4699784 [GRCh38]
Chr20:4680430 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.402G>C (p.Met134Ile) single nucleotide variant Huntington disease-like 1 [RCV002619891] Chr20:4699622 [GRCh38]
Chr20:4680268 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.451C>T (p.Arg151Cys) single nucleotide variant Huntington disease-like 1 [RCV003077726] Chr20:4699671 [GRCh38]
Chr20:4680317 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.138C>T (p.Gly46=) single nucleotide variant Huntington disease-like 1 [RCV003100235] Chr20:4699358 [GRCh38]
Chr20:4680004 [GRCh37]
Chr20:20p13		 likely benign|uncertain significance
NM_000311.5(PRNP):c.227_228insTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) microsatellite Huntington disease-like 1 [RCV002847207] Chr20:4699379..4699380 [GRCh38]
Chr20:4680025..4680026 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.120G>A (p.Gly40=) single nucleotide variant Huntington disease-like 1 [RCV002780237] Chr20:4699340 [GRCh38]
Chr20:4679986 [GRCh37]
Chr20:20p13		 benign
NM_000311.5(PRNP):c.446dup (p.Tyr149Ter) duplication Huntington disease-like 1 [RCV002917596] Chr20:4699665..4699666 [GRCh38]
Chr20:4680311..4680312 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.563C>T (p.Thr188Met) single nucleotide variant Huntington disease-like 1 [RCV002932164] Chr20:4699783 [GRCh38]
Chr20:4680429 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.286C>G (p.His96Asp) single nucleotide variant Inborn genetic diseases [RCV002955060] Chr20:4699506 [GRCh38]
Chr20:4680152 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.393A>G (p.Gly131=) single nucleotide variant Huntington disease-like 1 [RCV002624078] Chr20:4699613 [GRCh38]
Chr20:4680259 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.110G>A (p.Arg37Gln) single nucleotide variant Inborn genetic diseases [RCV002641730] Chr20:4699330 [GRCh38]
Chr20:4679976 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.505T>C (p.Tyr169His) single nucleotide variant Huntington disease-like 1 [RCV002596518] Chr20:4699725 [GRCh38]
Chr20:4680371 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.214G>C (p.Gly72Arg) single nucleotide variant Inborn genetic diseases [RCV002915098] Chr20:4699434 [GRCh38]
Chr20:4680080 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.74G>A (p.Arg25His) single nucleotide variant Huntington disease-like 1 [RCV002922918] Chr20:4699294 [GRCh38]
Chr20:4679940 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.563C>G (p.Thr188Arg) single nucleotide variant Huntington disease-like 1 [RCV003064598] Chr20:4699783 [GRCh38]
Chr20:4680429 [GRCh37]
Chr20:20p13		 likely pathogenic
NM_000311.5(PRNP):c.441C>T (p.Asp147=) single nucleotide variant Huntington disease-like 1 [RCV002589065] Chr20:4699661 [GRCh38]
Chr20:4680307 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.715C>T (p.Pro239Ser) single nucleotide variant Huntington disease-like 1 [RCV002654626] Chr20:4699935 [GRCh38]
Chr20:4680581 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.77C>T (p.Pro26Leu) single nucleotide variant not provided [RCV004790812] Chr20:4699297 [GRCh38]
Chr20:4679943 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13-12.3(chr20:3034557-5524417)x1 copy number loss See cases [RCV003158005] Chr20:3034557..5524417 [GRCh37]
Chr20:20p13-12.3		 likely pathogenic
GRCh38/hg38 20p13-11.21(chr20:87153-23635465)x3 copy number gain Renal agenesis [RCV003327640] Chr20:87153..23635465 [GRCh38]
Chr20:20p13-11.21		 pathogenic
NM_000311.5(PRNP):c.432C>G (p.Asp144Glu) single nucleotide variant not provided [RCV003327084] Chr20:4699652 [GRCh38]
Chr20:4680298 [GRCh37]
Chr20:20p13		 uncertain significance
GRCh37/hg19 20p13-12.2(chr20:61569-9542361)x3 copy number gain not provided [RCV003485207] Chr20:61569..9542361 [GRCh37]
Chr20:20p13-12.2		 pathogenic
NM_000311.5(PRNP):c.180TCATGGTGGTGGCTGGGGGCAGCC[3] (p.Gln91_Gly92insProHisGlyGlyGlyTrpGlyGln) microsatellite not provided [RCV003480348] Chr20:4699379..4699380 [GRCh38]
Chr20:4680025..4680026 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.190G>A (p.Gly64Ser) single nucleotide variant not provided [RCV004790813] Chr20:4699410 [GRCh38]
Chr20:4680056 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.705CTC[1] (p.Ser237del) microsatellite not provided [RCV003431253] Chr20:4699925..4699927 [GRCh38]
Chr20:4680571..4680573 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.423C>T (p.Phe141=) single nucleotide variant Huntington disease-like 1 [RCV003627104] Chr20:4699643 [GRCh38]
Chr20:4680289 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.350_351inv (p.Ala117Val) inversion Huntington disease-like 1 [RCV003627888] Chr20:4699570..4699571 [GRCh38]
Chr20:4680216..4680217 [GRCh37]
Chr20:20p13		 pathogenic
NM_000311.5(PRNP):c.674A>G (p.Tyr225Cys) single nucleotide variant Huntington disease-like 1 [RCV003626596] Chr20:4699894 [GRCh38]
Chr20:4680540 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.654C>G (p.Tyr218Ter) single nucleotide variant Huntington disease-like 1 [RCV003627977] Chr20:4699874 [GRCh38]
Chr20:4680520 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.54C>T (p.Asp18=) single nucleotide variant Huntington disease-like 1 [RCV003514214] Chr20:4699274 [GRCh38]
Chr20:4679920 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.487T>C (p.Tyr163His) single nucleotide variant Huntington disease-like 1 [RCV003514038] Chr20:4699707 [GRCh38]
Chr20:4680353 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.749T>C (p.Leu250Pro) single nucleotide variant Huntington disease-like 1 [RCV003514261] Chr20:4699969 [GRCh38]
Chr20:4680615 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.480A>G (p.Gln160=) single nucleotide variant Huntington disease-like 1 [RCV003870363] Chr20:4699700 [GRCh38]
Chr20:4680346 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.*5G>A single nucleotide variant PRNP-related disorder [RCV004531875] Chr20:4699987 [GRCh38]
Chr20:4680633 [GRCh37]
Chr20:20p13		 likely benign
GRCh37/hg19 20p13-12.1(chr20:68351-16142323)x3 copy number gain not provided [RCV003885494] Chr20:68351..16142323 [GRCh37]
Chr20:20p13-12.1		 pathogenic
GRCh37/hg19 20p13-11.21(chr20:68351-23860313)x3 copy number gain not provided [RCV003885495] Chr20:68351..23860313 [GRCh37]
Chr20:20p13-11.21		 pathogenic
NC_000020.10:g.(?_3190198)_(6760201_?)del deletion Inosine triphosphatase deficiency [RCV004579445] Chr20:3190198..6760201 [GRCh37]
Chr20:20p13-12.3		 pathogenic
NM_000311.5(PRNP):c.40G>T (p.Ala14Ser) single nucleotide variant Inborn genetic diseases [RCV004660326] Chr20:4699260 [GRCh38]
Chr20:4679906 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.88G>A (p.Gly30Arg) single nucleotide variant not provided [RCV004592464] Chr20:4699308 [GRCh38]
Chr20:4679954 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.218G>C (p.Trp73Ser) single nucleotide variant not provided [RCV004697436] Chr20:4699438 [GRCh38]
Chr20:4680084 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.666T>G (p.Ser222=) single nucleotide variant Huntington disease-like 1 [RCV005067285] Chr20:4699886 [GRCh38]
Chr20:4680532 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.684A>G (p.Arg228=) single nucleotide variant Huntington disease-like 1 [RCV005195208] Chr20:4699904 [GRCh38]
Chr20:4680550 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.576C>T (p.Thr192=) single nucleotide variant Huntington disease-like 1 [RCV005127233] Chr20:4699796 [GRCh38]
Chr20:4680442 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.33C>T (p.Leu11=) single nucleotide variant Huntington disease-like 1 [RCV005157176] Chr20:4699253 [GRCh38]
Chr20:4679899 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.162T>C (p.Gly54=) single nucleotide variant Huntington disease-like 1 [RCV005165031] Chr20:4699382 [GRCh38]
Chr20:4680028 [GRCh37]
Chr20:20p13		 likely benign
NM_000311.5(PRNP):c.304C>T (p.Pro102Ser) single nucleotide variant Gerstmann-Straussler-Scheinker syndrome [RCV005358146] Chr20:4699524 [GRCh38]
Chr20:4680170 [GRCh37]
Chr20:20p13		 likely pathogenic
NM_000311.5(PRNP):c.166G>A (p.Gly56Ser) single nucleotide variant Inborn genetic diseases [RCV005258650] Chr20:4699386 [GRCh38]
Chr20:4680032 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.244G>A (p.Gly82Arg) single nucleotide variant Inborn genetic diseases [RCV005258652] Chr20:4699464 [GRCh38]
Chr20:4680110 [GRCh37]
Chr20:20p13		 uncertain significance
NM_000311.5(PRNP):c.209G>T (p.Gly70Val) single nucleotide variant Inborn genetic diseases [RCV005258651] Chr20:4699429 [GRCh38]
Chr20:4680075 [GRCh37]
Chr20:20p13		 uncertain significance
miRNA Target Status (No longer updated)

Predicted Target Of
Summary Value
Count of predictions:1745
Count of miRNA genes:645
Interacting mature miRNAs:735
Transcripts:ENST00000379440, ENST00000424424, ENST00000430350, ENST00000457586
Prediction methods:Microtar, Miranda, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


QTLs in Region (GRCh38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
407021815GWAS670791_Hprion disease QTL GWAS670791 (human)0.0000007response to prion infection trait (VT:0010438)2046996054699606Human
597170750GWAS1266824_Hsurvival time, sporadic Creutzfeld Jacob disease QTL GWAS1266824 (human)3e-36brain integrity trait (VT:0010579)2046996054699606Human
407025067GWAS674043_HCreutzfeldt Jacob Disease QTL GWAS674043 (human)3e-18response to prion infection trait (VT:0010438)2046964464696447Human
407020777GWAS669753_HCreutzfeldt Jacob Disease QTL GWAS669753 (human)2e-21response to prion infection trait (VT:0010438)2046996054699606Human
596976857GWAS1096376_Hsurvival time, sporadic Creutzfeld Jacob disease QTL GWAS1096376 (human)3e-36survival time, sporadic Creutzfeld Jacob disease2046996054699606Human
597122010GWAS1218084_Hsporadic Creutzfeld Jacob disease QTL GWAS1218084 (human)1e-16brain integrity trait (VT:0010579)2046996054699606Human
597107208GWAS1203282_HKANNO antigen measurement QTL GWAS1203282 (human)3e-08KANNO antigen measurement2046888884688889Human
407040445GWAS689421_Hsporadic Creutzfeld Jacob disease QTL GWAS689421 (human)8e-09brain integrity trait (VT:0010579)2046964464696447Human

Markers in Region
WI-18738  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,681,070 - 4,681,213UniSTSGRCh37
Build 36204,629,070 - 4,629,213RGDNCBI36
Celera204,750,784 - 4,750,927RGD
Cytogenetic Map20p13UniSTS
HuRef204,634,468 - 4,634,611UniSTS
GeneMap99-GB4 RH Map2021.57UniSTS
Whitehead-RH Map2031.5UniSTS
NCBI RH Map2044.2UniSTS
SGC44304  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,682,037 - 4,682,172UniSTSGRCh37
Build 36204,630,037 - 4,630,172RGDNCBI36
Celera204,751,751 - 4,751,886RGD
Cytogenetic Map20p13UniSTS
HuRef204,635,435 - 4,635,570UniSTS
GeneMap99-GB4 RH Map2020.93UniSTS
Whitehead-RH Map2029.6UniSTS
NCBI RH Map2074.7UniSTS
GDB:181561  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,681,265 - 4,681,678UniSTSGRCh37
Build 36204,629,265 - 4,629,678RGDNCBI36
Celera204,750,979 - 4,751,392RGD
Cytogenetic Map20p13UniSTS
HuRef204,634,663 - 4,635,076UniSTS
GDB:607655  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,679,887 - 4,680,280UniSTSGRCh37
Build 36204,627,887 - 4,628,280RGDNCBI36
Celera204,749,601 - 4,749,994RGD
Cytogenetic Map20p13UniSTS
HuRef204,633,285 - 4,633,678UniSTS
PRNP-2  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,679,962 - 4,680,349UniSTSGRCh37
Build 36204,627,962 - 4,628,349RGDNCBI36
Celera204,749,676 - 4,750,063RGD
HuRef204,633,360 - 4,633,747UniSTS
PMC136957P1  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,679,859 - 4,680,638UniSTSGRCh37
Build 36204,627,859 - 4,628,638RGDNCBI36
Celera204,749,573 - 4,750,352RGD
Cytogenetic Map20p13UniSTS
HuRef204,633,257 - 4,634,036UniSTS
D20S1014  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,681,761 - 4,682,093UniSTSGRCh37
Build 36204,629,761 - 4,630,093RGDNCBI36
Celera204,751,475 - 4,751,807RGD
Cytogenetic Map20p13UniSTS
HuRef204,635,159 - 4,635,491UniSTS
Stanford-G3 RH Map20224.0UniSTS
GeneMap99-GB4 RH Map2012.19UniSTS
Whitehead-YAC Contig Map20 UniSTS
NCBI RH Map2036.6UniSTS
GeneMap99-G3 RH Map20224.0UniSTS
PRNP  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,680,550 - 4,680,624UniSTSGRCh37
Build 36204,628,550 - 4,628,624RGDNCBI36
Celera204,750,264 - 4,750,338RGD
HuRef204,633,948 - 4,634,022UniSTS
RH71030  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,680,008 - 4,680,280UniSTSGRCh37
Build 36204,628,008 - 4,628,280RGDNCBI36
Celera204,749,722 - 4,749,994RGD
Cytogenetic Map20p13UniSTS
HuRef204,633,406 - 4,633,678UniSTS
GeneMap99-GB4 RH Map2024.46UniSTS
NCBI RH Map2040.2UniSTS
RH47809  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37854,427,760 - 54,427,938UniSTSGRCh37
Build 36854,590,313 - 54,590,491RGDNCBI36
Celera850,418,526 - 50,418,704RGD
HuRef849,895,179 - 49,895,357UniSTS
GeneMap99-GB4 RH Map8299.46UniSTS
NCBI RH Map8771.3UniSTS
RH70248  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,681,871 - 4,682,110UniSTSGRCh37
Build 36204,629,871 - 4,630,110RGDNCBI36
Celera204,751,585 - 4,751,824RGD
Cytogenetic Map20p13UniSTS
HuRef204,635,269 - 4,635,508UniSTS
GeneMap99-GB4 RH Map2024.77UniSTS
NCBI RH Map2077.8UniSTS
RH71032  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37204,679,903 - 4,680,265UniSTSGRCh37
Build 36204,627,903 - 4,628,265RGDNCBI36
Celera204,749,617 - 4,749,979RGD
Cytogenetic Map20p13UniSTS
HuRef204,633,301 - 4,633,663UniSTS
GeneMap99-GB4 RH Map2021.14UniSTS
NCBI RH Map2039.5UniSTS


Expression

RNA-SEQ Expression

adipose tissue
alimentary part of gastrointestinal system
appendage
circulatory system
ectoderm
endocrine system
endoderm
entire extraembryonic component
exocrine system
hemolymphoid system
hepatobiliary system
integumental system
mesenchyme
mesoderm
musculoskeletal system
nervous system
pharyngeal arch
renal system
reproductive system
respiratory system
sensory system
visual system
1204 2438 2788 2253 4974 1726 2351 6 624 1951 465 2270 7306 6472 53 3734 1 852 1744 1617 175 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_009087 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000311 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080122 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001080123 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001271561 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_183079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB300823 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB300824 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB300825 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AB300826 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF030575 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF076976 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF085477 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF315723 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AI131269 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ289875 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK090575 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK293312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK295415 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK295943 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK312276 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL133396 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AW452130 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY008282 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY219882 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY219883 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY458651 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY569456 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC012844 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC016809 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC022532 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BG397054 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BI669189 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BK007887 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BP251427 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BT019496 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CP068258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR542039 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CR542072 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  D00015 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DA122620 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DA297032 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DB461478 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DB485147 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DC325819 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ408531 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EF139172 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GU564468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  HM459606 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC550028 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC574065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC842280 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LC842281 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M13667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M13899 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M81929 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M81930 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423298 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423299 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423300 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423301 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423302 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423303 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423304 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423305 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423306 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423307 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423308 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423309 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423310 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423311 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423313 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423314 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423315 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423316 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423317 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423318 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423319 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423320 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423321 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423322 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423323 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423324 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423325 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423326 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423327 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423328 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423329 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423330 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423331 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423332 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423333 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423334 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423335 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423336 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423337 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423338 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423339 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423340 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423341 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423342 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423343 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423344 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423345 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423346 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423347 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423348 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423349 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423350 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423351 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423352 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423353 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423354 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423355 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423356 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423357 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423358 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423359 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423360 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423361 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423362 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423363 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423364 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423365 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423366 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423367 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423368 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423369 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423370 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423371 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423372 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423374 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423375 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423376 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423377 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423378 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423379 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423380 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423381 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423382 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423383 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423384 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423385 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423386 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423387 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423388 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423389 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423390 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423391 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423392 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423393 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423394 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423395 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423396 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423397 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423398 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423399 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423400 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423401 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423402 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423403 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423404 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423405 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423406 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423407 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423408 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423409 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423410 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423411 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423412 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423413 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423414 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423415 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  ON423416 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S71208 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S71210 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S71212 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S79978 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S80539 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S80732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S80743 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S82948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S83341 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U29185 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X82545 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X83416 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Ensembl Acc Id: ENST00000379440   ⟹   ENSP00000368752
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl204,686,456 - 4,701,588 (+)Ensembl
Ensembl Acc Id: ENST00000424424   ⟹   ENSP00000411599
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl204,686,459 - 4,701,590 (+)Ensembl
Ensembl Acc Id: ENST00000430350   ⟹   ENSP00000399376
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl204,686,350 - 4,701,590 (+)Ensembl
Ensembl Acc Id: ENST00000457586   ⟹   ENSP00000415284
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p14 Ensembl204,686,543 - 4,701,590 (+)Ensembl
RefSeq Acc Id: NM_000311   ⟹   NP_000302
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
Build 36204,614,797 - 4,630,234 (+)NCBI Archive
HuRef204,620,194 - 4,635,632 (+)ENTREZGENE
CHM1_1204,667,528 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001080121   ⟹   NP_001073590
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
Build 36204,614,797 - 4,630,234 (+)NCBI Archive
HuRef204,620,194 - 4,635,632 (+)ENTREZGENE
CHM1_1204,667,528 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001080122   ⟹   NP_001073591
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
Build 36204,614,797 - 4,630,234 (+)NCBI Archive
HuRef204,620,194 - 4,635,632 (+)ENTREZGENE
CHM1_1204,667,528 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001080123   ⟹   NP_001073592
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
Build 36204,615,157 - 4,630,234 (+)NCBI Archive
HuRef204,620,194 - 4,635,632 (+)ENTREZGENE
CHM1_1204,667,888 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001271561   ⟹   NP_001258490
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
HuRef204,620,194 - 4,635,632 (+)NCBI
CHM1_1204,667,528 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
RefSeq Acc Id: NM_183079   ⟹   NP_898902
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,701,588 (+)NCBI
GRCh37204,666,797 - 4,682,235 (+)NCBI
Build 36204,614,797 - 4,630,234 (+)NCBI Archive
HuRef204,620,194 - 4,635,632 (+)ENTREZGENE
CHM1_1204,667,528 - 4,682,967 (+)NCBI
T2T-CHM13v2.0204,725,692 - 4,740,800 (+)NCBI
Sequence:
Protein Sequences
Protein RefSeqs NP_000302 (Get FASTA)   NCBI Sequence Viewer  
  NP_001073590 (Get FASTA)   NCBI Sequence Viewer  
  NP_001073591 (Get FASTA)   NCBI Sequence Viewer  
  NP_001073592 (Get FASTA)   NCBI Sequence Viewer  
  NP_001258490 (Get FASTA)   NCBI Sequence Viewer  
  NP_898902 (Get FASTA)   NCBI Sequence Viewer  
GenBank Protein AAA19664 (Get FASTA)   NCBI Sequence Viewer  
  AAA60182 (Get FASTA)   NCBI Sequence Viewer  
  AAB20521 (Get FASTA)   NCBI Sequence Viewer  
  AAB20522 (Get FASTA)   NCBI Sequence Viewer  
  AAB20523 (Get FASTA)   NCBI Sequence Viewer  
  AAB21334 (Get FASTA)   NCBI Sequence Viewer  
  AAB35416 (Get FASTA)   NCBI Sequence Viewer  
  AAB50648 (Get FASTA)   NCBI Sequence Viewer  
  AAB50649 (Get FASTA)   NCBI Sequence Viewer  
  AAB50777 (Get FASTA)   NCBI Sequence Viewer  
  AAB59442 (Get FASTA)   NCBI Sequence Viewer  
  AAB59443 (Get FASTA)   NCBI Sequence Viewer  
  AAC05365 (Get FASTA)   NCBI Sequence Viewer  
  AAC62750 (Get FASTA)   NCBI Sequence Viewer  
  AAC78725 (Get FASTA)   NCBI Sequence Viewer  
  AAD15012 (Get FASTA)   NCBI Sequence Viewer  
  AAD46098 (Get FASTA)   NCBI Sequence Viewer  
  AAG21693 (Get FASTA)   NCBI Sequence Viewer  
  AAH12844 (Get FASTA)   NCBI Sequence Viewer  
  AAH22532 (Get FASTA)   NCBI Sequence Viewer  
  AAO83635 (Get FASTA)   NCBI Sequence Viewer  
  AAO83636 (Get FASTA)   NCBI Sequence Viewer  
  AAR21603 (Get FASTA)   NCBI Sequence Viewer  
  AAS80162 (Get FASTA)   NCBI Sequence Viewer  
  AAV38303 (Get FASTA)   NCBI Sequence Viewer  
  ABD63004 (Get FASTA)   NCBI Sequence Viewer  
  ABL75508 (Get FASTA)   NCBI Sequence Viewer  
  ADD71057 (Get FASTA)   NCBI Sequence Viewer  
  ADO16981 (Get FASTA)   NCBI Sequence Viewer  
  BAA00011 (Get FASTA)   NCBI Sequence Viewer  
  BAG32276 (Get FASTA)   NCBI Sequence Viewer  
  BAG32277 (Get FASTA)   NCBI Sequence Viewer  
  BAG32278 (Get FASTA)   NCBI Sequence Viewer  
  BAG32279 (Get FASTA)   NCBI Sequence Viewer  
  BAG35206 (Get FASTA)   NCBI Sequence Viewer  
  BAG52189 (Get FASTA)   NCBI Sequence Viewer  
  BAG56832 (Get FASTA)   NCBI Sequence Viewer  
  BAG58365 (Get FASTA)   NCBI Sequence Viewer  
  BAG58727 (Get FASTA)   NCBI Sequence Viewer  
  BCG28117 (Get FASTA)   NCBI Sequence Viewer  
  BCK59655 (Get FASTA)   NCBI Sequence Viewer  
  CAA57895 (Get FASTA)   NCBI Sequence Viewer  
  CAA58442 (Get FASTA)   NCBI Sequence Viewer  
  CAG46836 (Get FASTA)   NCBI Sequence Viewer  
  CAG46869 (Get FASTA)   NCBI Sequence Viewer  
  DAA34790 (Get FASTA)   NCBI Sequence Viewer  
  EAX10449 (Get FASTA)   NCBI Sequence Viewer  
  EAX10450 (Get FASTA)   NCBI Sequence Viewer  
Ensembl Protein ENSP00000368752
  ENSP00000368752.4
  ENSP00000399376
  ENSP00000399376.2
  ENSP00000411599
  ENSP00000411599.2
  ENSP00000415284
  ENSP00000415284.2
GenBank Protein F7VJQ1 (Get FASTA)   NCBI Sequence Viewer  
  P04156 (Get FASTA)   NCBI Sequence Viewer  
  URQ09589 (Get FASTA)   NCBI Sequence Viewer  
  URQ09590 (Get FASTA)   NCBI Sequence Viewer  
  URQ09591 (Get FASTA)   NCBI Sequence Viewer  
  URQ09592 (Get FASTA)   NCBI Sequence Viewer  
  URQ09593 (Get FASTA)   NCBI Sequence Viewer  
  URQ09594 (Get FASTA)   NCBI Sequence Viewer  
  URQ09595 (Get FASTA)   NCBI Sequence Viewer  
  URQ09596 (Get FASTA)   NCBI Sequence Viewer  
  URQ09597 (Get FASTA)   NCBI Sequence Viewer  
  URQ09598 (Get FASTA)   NCBI Sequence Viewer  
  URQ09599 (Get FASTA)   NCBI Sequence Viewer  
  URQ09600 (Get FASTA)   NCBI Sequence Viewer  
  URQ09601 (Get FASTA)   NCBI Sequence Viewer  
  URQ09602 (Get FASTA)   NCBI Sequence Viewer  
  URQ09603 (Get FASTA)   NCBI Sequence Viewer  
  URQ09604 (Get FASTA)   NCBI Sequence Viewer  
  URQ09605 (Get FASTA)   NCBI Sequence Viewer  
  URQ09606 (Get FASTA)   NCBI Sequence Viewer  
  URQ09607 (Get FASTA)   NCBI Sequence Viewer  
  URQ09608 (Get FASTA)   NCBI Sequence Viewer  
  URQ09609 (Get FASTA)   NCBI Sequence Viewer  
  URQ09610 (Get FASTA)   NCBI Sequence Viewer  
  URQ09611 (Get FASTA)   NCBI Sequence Viewer  
  URQ09612 (Get FASTA)   NCBI Sequence Viewer  
  URQ09613 (Get FASTA)   NCBI Sequence Viewer  
  URQ09614 (Get FASTA)   NCBI Sequence Viewer  
  URQ09615 (Get FASTA)   NCBI Sequence Viewer  
  URQ09616 (Get FASTA)   NCBI Sequence Viewer  
  URQ09617 (Get FASTA)   NCBI Sequence Viewer  
  URQ09618 (Get FASTA)   NCBI Sequence Viewer  
  URQ09619 (Get FASTA)   NCBI Sequence Viewer  
  URQ09620 (Get FASTA)   NCBI Sequence Viewer  
  URQ09621 (Get FASTA)   NCBI Sequence Viewer  
  URQ09622 (Get FASTA)   NCBI Sequence Viewer  
  URQ09623 (Get FASTA)   NCBI Sequence Viewer  
  URQ09624 (Get FASTA)   NCBI Sequence Viewer  
  URQ09625 (Get FASTA)   NCBI Sequence Viewer  
  URQ09626 (Get FASTA)   NCBI Sequence Viewer  
  URQ09627 (Get FASTA)   NCBI Sequence Viewer  
  URQ09628 (Get FASTA)   NCBI Sequence Viewer  
  URQ09629 (Get FASTA)   NCBI Sequence Viewer  
  URQ09630 (Get FASTA)   NCBI Sequence Viewer  
  URQ09631 (Get FASTA)   NCBI Sequence Viewer  
  URQ09632 (Get FASTA)   NCBI Sequence Viewer  
  URQ09633 (Get FASTA)   NCBI Sequence Viewer  
  URQ09634 (Get FASTA)   NCBI Sequence Viewer  
  URQ09635 (Get FASTA)   NCBI Sequence Viewer  
  URQ09636 (Get FASTA)   NCBI Sequence Viewer  
  URQ09637 (Get FASTA)   NCBI Sequence Viewer  
  URQ09638 (Get FASTA)   NCBI Sequence Viewer  
  URQ09639 (Get FASTA)   NCBI Sequence Viewer  
  URQ09640 (Get FASTA)   NCBI Sequence Viewer  
  URQ09641 (Get FASTA)   NCBI Sequence Viewer  
  URQ09642 (Get FASTA)   NCBI Sequence Viewer  
  URQ09643 (Get FASTA)   NCBI Sequence Viewer  
  URQ09644 (Get FASTA)   NCBI Sequence Viewer  
  URQ09645 (Get FASTA)   NCBI Sequence Viewer  
  URQ09646 (Get FASTA)   NCBI Sequence Viewer  
  URQ09647 (Get FASTA)   NCBI Sequence Viewer  
  URQ09648 (Get FASTA)   NCBI Sequence Viewer  
  URQ09649 (Get FASTA)   NCBI Sequence Viewer  
  URQ09650 (Get FASTA)   NCBI Sequence Viewer  
  URQ09651 (Get FASTA)   NCBI Sequence Viewer  
  URQ09652 (Get FASTA)   NCBI Sequence Viewer  
  URQ09653 (Get FASTA)   NCBI Sequence Viewer  
  URQ09654 (Get FASTA)   NCBI Sequence Viewer  
  URQ09655 (Get FASTA)   NCBI Sequence Viewer  
  URQ09656 (Get FASTA)   NCBI Sequence Viewer  
  URQ09657 (Get FASTA)   NCBI Sequence Viewer  
  URQ09658 (Get FASTA)   NCBI Sequence Viewer  
  URQ09659 (Get FASTA)   NCBI Sequence Viewer  
  URQ09660 (Get FASTA)   NCBI Sequence Viewer  
  URQ09661 (Get FASTA)   NCBI Sequence Viewer  
  URQ09662 (Get FASTA)   NCBI Sequence Viewer  
  URQ09663 (Get FASTA)   NCBI Sequence Viewer  
  URQ09664 (Get FASTA)   NCBI Sequence Viewer  
  URQ09665 (Get FASTA)   NCBI Sequence Viewer  
  URQ09666 (Get FASTA)   NCBI Sequence Viewer  
  URQ09667 (Get FASTA)   NCBI Sequence Viewer  
  URQ09668 (Get FASTA)   NCBI Sequence Viewer  
  URQ09669 (Get FASTA)   NCBI Sequence Viewer  
  URQ09670 (Get FASTA)   NCBI Sequence Viewer  
  URQ09671 (Get FASTA)   NCBI Sequence Viewer  
  URQ09672 (Get FASTA)   NCBI Sequence Viewer  
  URQ09673 (Get FASTA)   NCBI Sequence Viewer  
  URQ09674 (Get FASTA)   NCBI Sequence Viewer  
  URQ09675 (Get FASTA)   NCBI Sequence Viewer  
  URQ09676 (Get FASTA)   NCBI Sequence Viewer  
  URQ09677 (Get FASTA)   NCBI Sequence Viewer  
  URQ09678 (Get FASTA)   NCBI Sequence Viewer  
  URQ09679 (Get FASTA)   NCBI Sequence Viewer  
  URQ09680 (Get FASTA)   NCBI Sequence Viewer  
  URQ09681 (Get FASTA)   NCBI Sequence Viewer  
  URQ09682 (Get FASTA)   NCBI Sequence Viewer  
  URQ09683 (Get FASTA)   NCBI Sequence Viewer  
  URQ09684 (Get FASTA)   NCBI Sequence Viewer  
  URQ09685 (Get FASTA)   NCBI Sequence Viewer  
  URQ09686 (Get FASTA)   NCBI Sequence Viewer  
  URQ09687 (Get FASTA)   NCBI Sequence Viewer  
  URQ09688 (Get FASTA)   NCBI Sequence Viewer  
  URQ09689 (Get FASTA)   NCBI Sequence Viewer  
  URQ09690 (Get FASTA)   NCBI Sequence Viewer  
  URQ09691 (Get FASTA)   NCBI Sequence Viewer  
  URQ09692 (Get FASTA)   NCBI Sequence Viewer  
  URQ09693 (Get FASTA)   NCBI Sequence Viewer  
  URQ09694 (Get FASTA)   NCBI Sequence Viewer  
  URQ09695 (Get FASTA)   NCBI Sequence Viewer  
  URQ09696 (Get FASTA)   NCBI Sequence Viewer  
  URQ09697 (Get FASTA)   NCBI Sequence Viewer  
  URQ09698 (Get FASTA)   NCBI Sequence Viewer  
  URQ09699 (Get FASTA)   NCBI Sequence Viewer  
  URQ09700 (Get FASTA)   NCBI Sequence Viewer  
  URQ09701 (Get FASTA)   NCBI Sequence Viewer  
  URQ09702 (Get FASTA)   NCBI Sequence Viewer  
  URQ09703 (Get FASTA)   NCBI Sequence Viewer  
  URQ09704 (Get FASTA)   NCBI Sequence Viewer  
  URQ09705 (Get FASTA)   NCBI Sequence Viewer  
  URQ09706 (Get FASTA)   NCBI Sequence Viewer  
  URQ09707 (Get FASTA)   NCBI Sequence Viewer  
RefSeq Acc Id: NP_000302   ⟸   NM_000311
- Peptide Label: preproprotein Prp precursor
- UniProtKB: Q96E70 (UniProtKB/Swiss-Prot),   Q8TBG0 (UniProtKB/Swiss-Prot),   Q5QPB4 (UniProtKB/Swiss-Prot),   Q27H91 (UniProtKB/Swiss-Prot),   Q15221 (UniProtKB/Swiss-Prot),   Q15216 (UniProtKB/Swiss-Prot),   P78446 (UniProtKB/Swiss-Prot),   O60489 (UniProtKB/Swiss-Prot),   Q9UP19 (UniProtKB/Swiss-Prot),   P04156 (UniProtKB/Swiss-Prot),   Q53YK7 (UniProtKB/TrEMBL),   A0A6J4EE43 (UniProtKB/TrEMBL),   B2R5Q9 (UniProtKB/TrEMBL),   Q6FGN5 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001073590   ⟸   NM_001080121
- Peptide Label: preproprotein Prp precursor
- UniProtKB: Q96E70 (UniProtKB/Swiss-Prot),   Q8TBG0 (UniProtKB/Swiss-Prot),   Q5QPB4 (UniProtKB/Swiss-Prot),   Q27H91 (UniProtKB/Swiss-Prot),   Q15221 (UniProtKB/Swiss-Prot),   Q15216 (UniProtKB/Swiss-Prot),   P78446 (UniProtKB/Swiss-Prot),   O60489 (UniProtKB/Swiss-Prot),   Q9UP19 (UniProtKB/Swiss-Prot),   P04156 (UniProtKB/Swiss-Prot),   Q53YK7 (UniProtKB/TrEMBL),   A0A6J4EE43 (UniProtKB/TrEMBL),   B2R5Q9 (UniProtKB/TrEMBL),   Q6FGN5 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_898902   ⟸   NM_183079
- Peptide Label: preproprotein Prp precursor
- UniProtKB: Q96E70 (UniProtKB/Swiss-Prot),   Q8TBG0 (UniProtKB/Swiss-Prot),   Q5QPB4 (UniProtKB/Swiss-Prot),   Q27H91 (UniProtKB/Swiss-Prot),   Q15221 (UniProtKB/Swiss-Prot),   Q15216 (UniProtKB/Swiss-Prot),   P78446 (UniProtKB/Swiss-Prot),   O60489 (UniProtKB/Swiss-Prot),   Q9UP19 (UniProtKB/Swiss-Prot),   P04156 (UniProtKB/Swiss-Prot),   Q53YK7 (UniProtKB/TrEMBL),   A0A6J4EE43 (UniProtKB/TrEMBL),   B2R5Q9 (UniProtKB/TrEMBL),   Q6FGN5 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001073591   ⟸   NM_001080122
- Peptide Label: preproprotein Prp precursor
- UniProtKB: Q96E70 (UniProtKB/Swiss-Prot),   Q8TBG0 (UniProtKB/Swiss-Prot),   Q5QPB4 (UniProtKB/Swiss-Prot),   Q27H91 (UniProtKB/Swiss-Prot),   Q15221 (UniProtKB/Swiss-Prot),   Q15216 (UniProtKB/Swiss-Prot),   P78446 (UniProtKB/Swiss-Prot),   O60489 (UniProtKB/Swiss-Prot),   Q9UP19 (UniProtKB/Swiss-Prot),   P04156 (UniProtKB/Swiss-Prot),   Q53YK7 (UniProtKB/TrEMBL),   A0A6J4EE43 (UniProtKB/TrEMBL),   B2R5Q9 (UniProtKB/TrEMBL),   Q6FGN5 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001073592   ⟸   NM_001080123
- Peptide Label: preproprotein Prp precursor
- UniProtKB: Q96E70 (UniProtKB/Swiss-Prot),   Q8TBG0 (UniProtKB/Swiss-Prot),   Q5QPB4 (UniProtKB/Swiss-Prot),   Q27H91 (UniProtKB/Swiss-Prot),   Q15221 (UniProtKB/Swiss-Prot),   Q15216 (UniProtKB/Swiss-Prot),   P78446 (UniProtKB/Swiss-Prot),   O60489 (UniProtKB/Swiss-Prot),   Q9UP19 (UniProtKB/Swiss-Prot),   P04156 (UniProtKB/Swiss-Prot),   Q53YK7 (UniProtKB/TrEMBL),   A0A6J4EE43 (UniProtKB/TrEMBL),   B2R5Q9 (UniProtKB/TrEMBL),   Q6FGN5 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001258490   ⟸   NM_001271561
- Peptide Label: isoform AltPrp
- UniProtKB: F7VJQ1 (UniProtKB/Swiss-Prot),   K0P2W7 (UniProtKB/TrEMBL)
- Sequence:
Ensembl Acc Id: ENSP00000411599   ⟸   ENST00000424424
Ensembl Acc Id: ENSP00000415284   ⟸   ENST00000457586
Ensembl Acc Id: ENSP00000368752   ⟸   ENST00000379440
Ensembl Acc Id: ENSP00000399376   ⟸   ENST00000430350
Protein Domains
Prion/Doppel protein beta-ribbon

Protein Structures
Name Modeler Protein Id AA Range Protein Structure
AF-P04156-F1-model_v2 AlphaFold P04156 1-253 view protein structure

Promoters
RGD ID:6798912
Promoter ID:HG_KWN:38471
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:CD4+TCell,   CD4+TCell_12Hour,   HeLa_S3,   K562,   Lymphoblastoid,   NB4
Transcripts:NM_001080121,   NM_001080122,   NM_001080123,   OTTHUMT00000077820,   OTTHUMT00000077821,   UC002WKT.1
Position:
Human AssemblyChrPosition (strand)Source
Build 36204,614,844 - 4,615,344 (+)MPROMDB
RGD ID:6850760
Promoter ID:EP73174
Type:multiple initiation site
Name:HS_PRNP
Description:Prion protein (p27-30) (Creutzfeld-Jakob disease,Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia).
SO ACC ID:SO:0000170
Source:EPD (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:NEDO full length human cDNA sequencing project.; Oligo-capping
Position:
Human AssemblyChrPosition (strand)Source
Build 36204,615,105 - 4,615,165EPD
RGD ID:13206283
Promoter ID:EPDNEW_H26722
Type:initiation region
Name:PRNP_1
Description:prion protein
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh38204,686,456 - 4,686,516EPDNEW

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:9449 AgrOrtholog
COSMIC PRNP COSMIC
Ensembl Genes ENSG00000171867 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000379440 ENTREZGENE
  ENST00000379440.9 UniProtKB/Swiss-Prot
  ENST00000424424 ENTREZGENE
  ENST00000424424.2 UniProtKB/Swiss-Prot
  ENST00000430350 ENTREZGENE
  ENST00000430350.2 UniProtKB/Swiss-Prot
  ENST00000457586 ENTREZGENE
  ENST00000457586.2 UniProtKB/Swiss-Prot
Gene3D-CATH 1.10.790.10 UniProtKB/Swiss-Prot
GTEx ENSG00000171867 GTEx
HGNC ID HGNC:9449 ENTREZGENE
Human Proteome Map PRNP Human Proteome Map
InterPro Prion UniProtKB/Swiss-Prot
  Prion/Doppel_b-ribbon_dom_sf UniProtKB/Swiss-Prot
  Prion/Doppel_prot_b-ribbon_dom UniProtKB/Swiss-Prot
  Prion_copper_b_octapeptide UniProtKB/Swiss-Prot
  Prion_N_dom UniProtKB/Swiss-Prot
KEGG Report hsa:5621 UniProtKB/Swiss-Prot
NCBI Gene 5621 ENTREZGENE
OMIM 176640 OMIM
PANTHER DOPPEL PRION UniProtKB/Swiss-Prot
  MAJOR PRION PROTEIN UniProtKB/Swiss-Prot
Pfam Prion UniProtKB/Swiss-Prot
  Prion_bPrPp UniProtKB/Swiss-Prot
  Prion_octapep UniProtKB/Swiss-Prot
PharmGKB PA33796 PharmGKB
PRINTS PRION UniProtKB/Swiss-Prot
PROSITE PRION_1 UniProtKB/Swiss-Prot
  PRION_2 UniProtKB/Swiss-Prot
SMART PRP UniProtKB/Swiss-Prot
Superfamily-SCOP SSF54098 UniProtKB/Swiss-Prot
UniProt A0A6J4EE43 ENTREZGENE, UniProtKB/TrEMBL
  A1YVW6_HUMAN UniProtKB/TrEMBL
  A2A2V1_HUMAN UniProtKB/TrEMBL
  APRIO_HUMAN UniProtKB/Swiss-Prot
  B2NI04_HUMAN UniProtKB/TrEMBL
  B2NI05_HUMAN UniProtKB/TrEMBL
  B2R5Q9 ENTREZGENE, UniProtKB/TrEMBL
  D4P3Q7_HUMAN UniProtKB/TrEMBL
  F7VJQ1 ENTREZGENE
  K0P2W7 ENTREZGENE, UniProtKB/TrEMBL
  O60489 ENTREZGENE
  O75942_HUMAN UniProtKB/TrEMBL
  P04156 ENTREZGENE
  P78446 ENTREZGENE
  PRIO_HUMAN UniProtKB/Swiss-Prot
  Q15216 ENTREZGENE
  Q15221 ENTREZGENE
  Q16409_HUMAN UniProtKB/TrEMBL
  Q27H91 ENTREZGENE
  Q53YK7 ENTREZGENE, UniProtKB/TrEMBL
  Q540C4_HUMAN UniProtKB/TrEMBL
  Q5QPB4 ENTREZGENE
  Q6FGN5 ENTREZGENE, UniProtKB/TrEMBL
  Q6FGR8_HUMAN UniProtKB/TrEMBL
  Q6SES1_HUMAN UniProtKB/TrEMBL
  Q7KYY8_HUMAN UniProtKB/TrEMBL
  Q86XR1_HUMAN UniProtKB/TrEMBL
  Q8TBG0 ENTREZGENE
  Q96E70 ENTREZGENE
  Q9UP19 ENTREZGENE
  X6RKS3_HUMAN UniProtKB/TrEMBL
UniProt Secondary O60489 UniProtKB/Swiss-Prot
  P78446 UniProtKB/Swiss-Prot
  Q15216 UniProtKB/Swiss-Prot
  Q15221 UniProtKB/Swiss-Prot
  Q27H91 UniProtKB/Swiss-Prot
  Q5QPB4 UniProtKB/Swiss-Prot
  Q8TBG0 UniProtKB/Swiss-Prot
  Q96E70 UniProtKB/Swiss-Prot
  Q9UP19 UniProtKB/Swiss-Prot


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2023-12-18 PRNP  prion protein (Kanno blood group)  PRNP  prion protein  Symbol and/or name change 19259463 PROVISIONAL