GJA5 (gap junction protein alpha 5) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: GJA5 (gap junction protein alpha 5) Homo sapiens
Analyze
Symbol: GJA5
Name: gap junction protein alpha 5
RGD ID: 736164
HGNC Page HGNC
Description: Enables gap junction channel activity. Involved in several processes, including cell communication by electrical coupling involved in cardiac conduction; circulatory system development; and regulation of cardiac muscle cell action potential. Located in gap junction and intercalated disc. Is integral component of plasma membrane. Part of connexin complex. Implicated in atrial fibrillation; atrial standstill 1; familial atrial fibrillation; and tetralogy of Fallot. Biomarker of atrial fibrillation.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: ATFB11; connexin 40; connexin-40; CX40; gap junction alpha-5 protein; gap junction membrane channel protein alpha 5; gap junction protein alpha 5 40kDa; MGC11185
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1147,756,199 - 147,773,362 (-)EnsemblGRCh38hg38GRCh38
GRCh381147,756,199 - 147,781,127 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh371147,228,332 - 147,245,455 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361145,694,956 - 145,712,108 (-)NCBINCBI36hg18NCBI36
Build 341144,453,708 - 144,457,501NCBI
Celera1121,738,476 - 121,755,641 (+)NCBI
Cytogenetic Map1q21.2NCBI
HuRef1120,641,850 - 120,658,997 (-)NCBIHuRef
CHM1_11149,124,325 - 149,141,488 (-)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene Ontology Annotations     Click to see Annotation Detail View

Biological Process
angiogenesis  (IEP)
artery morphogenesis  (ISS)
atrial cardiac muscle cell to AV node cell communication by electrical coupling  (IMP,NAS)
atrial septum development  (IMP)
atrial septum morphogenesis  (ISO)
atrial ventricular junction remodeling  (ISO)
AV node cell to bundle of His cell communication  (ISO)
AV node cell to bundle of His cell communication by electrical coupling  (IMP)
blood vessel development  (ISO)
blood vessel diameter maintenance  (ISO)
bundle of His cell to Purkinje myocyte communication by electrical coupling  (IMP,ISS)
cardiac conduction  (ISO)
cardiac conduction system development  (ISS)
cell communication  (IEA)
cell communication by chemical coupling  (IEA,ISO)
cell communication by electrical coupling  (ISO)
cell communication by electrical coupling involved in cardiac conduction  (IDA,ISO)
cell communication involved in cardiac conduction  (ISO)
cell-cell signaling  (IBA)
cellular response to platelet-derived growth factor stimulus  (ISO)
embryonic heart tube development  (ISO)
embryonic limb morphogenesis  (ISO)
endothelium development  (IEA,ISO)
foramen ovale closure  (ISO)
gap junction assembly  (IDA,IMP)
heart development  (ISO)
mitral valve development  (IMP)
negative regulation of blood pressure  (IEA,ISO)
negative regulation of glomerular filtration  (IEA,ISO)
outflow tract morphogenesis  (IMP)
positive regulation of cell communication by chemical coupling  (IEA,ISO)
positive regulation of vasoconstriction  (IEA,ISO)
potassium ion transport  (IEA,ISO)
pulmonary valve formation  (IMP)
Purkinje myocyte to ventricular cardiac muscle cell communication by electrical coupling  (NAS)
regulation of atrial cardiac muscle cell action potential  (IMP)
regulation of atrial cardiac muscle cell membrane depolarization  (IMP,ISO)
regulation of AV node cell action potential  (IMP)
regulation of bundle of His cell action potential  (IMP)
regulation of cardiac muscle contraction  (IMP)
regulation of cell communication by electrical coupling  (IEA,ISO)
regulation of heart rate by cardiac conduction  (ISO)
regulation of membrane depolarization during cardiac muscle cell action potential  (ISO)
regulation of Purkinje myocyte action potential  (IMP)
regulation of renin secretion into blood stream  (ISO)
regulation of systemic arterial blood pressure  (ISO)
regulation of ventricular cardiac muscle cell membrane depolarization  (ISO,ISS)
regulation of ventricular cardiac muscle cell membrane repolarization  (ISO,ISS)
renal system process involved in regulation of systemic arterial blood pressure  (ISO)
SA node cell action potential  (ISO)
SA node cell to atrial cardiac muscle cell communication by electrical coupling  (NAS)
septum primum development  (ISO)
skeletal system development  (ISO)
transmembrane transport  (IEA)
vasodilation  (IEA,ISO)
vasomotion  (IEA,ISO)
ventricular cardiac muscle cell action potential  (ISO)
ventricular septum development  (IMP)
ventricular septum morphogenesis  (ISO)

Cellular Component

Molecular Pathway Annotations     Click to see Annotation Detail View
References

References - curated
1. Avila MA, etal., J Neurotrauma. 2011 Sep;28(9):1803-11. doi: 10.1089/neu.2011.1900. Epub 2011 Sep 6.
2. Figueroa XF, etal., Physiology (Bethesda). 2004 Oct;19:277-84.
3. GOA_HUMAN data from the GO Consortium
4. Gollob MH, etal., N Engl J Med. 2006 Jun 22;354(25):2677-88.
5. Haefliger JA, etal., Kidney Int. 2001 Jul;60(1):190-201.
6. Li L, etal., Am J Physiol Cell Physiol. 2007 Nov;293(5):C1627-35. Epub 2007 Sep 13.
7. Ma J, etal., Biomed Pharmacother. 2018 Apr;100:156-167. doi: 10.1016/j.biopha.2018.02.013. Epub 2018 Feb 8.
8. Ming J, etal., Shock. 2009 Jan;31(1):80-6. doi: 10.1097/SHK.0b013e31817d3eF2-11.
9. Morioka T, etal., Clin Exp Nephrol. 2012 Sep 4.
10. OMIM Disease Annotation Pipeline
11. Online Mendelian Inheritance in Man, OMIM (TM).
12. Polontchouk L, etal., J Am Coll Cardiol. 2001 Sep;38(3):883-91.
13. RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
14. RGD automated import pipeline for gene-chemical interactions
15. RGD automated import pipeline for human HPO-to-gene-to-disease annotations
16. Rignault S, etal., Crit Care Med. 2005 Jun;33(6):1302-10.
17. Rummery NM, etal., J Hypertens. 2002 Feb;20(2):247-53.
18. Silverstein DM, etal., Pediatr Nephrol. 2003 Mar;18(3):216-24. Epub 2003 Feb 7.
19. Soemedi R, etal., Hum Mol Genet. 2012 Apr 1;21(7):1513-20. doi: 10.1093/hmg/ddr589. Epub 2011 Dec 22.
20. Yamaguchi N, etal., Eur J Pharmacol. 2009 Oct 12;620(1-3):71-7. doi: 10.1016/j.ejphar.2009.08.005. Epub 2009 Aug 14.
21. Young EJ, etal., Diabetologia. 2008 May;51(5):872-81. doi: 10.1007/s00125-008-0934-y. Epub 2008 Mar 7.
22. Zheng YF, etal., J Pharm Pharmacol. 2010 May;62(5):615-21. doi: 10.1211/jpp/62.05.0009.
Additional References at PubMed
PMID:1310450   PMID:1964417   PMID:7877871   PMID:7966354   PMID:8561862   PMID:8889548   PMID:9119381   PMID:9523149   PMID:9617570   PMID:10336839   PMID:10581143   PMID:10728420  
PMID:10792506   PMID:10873295   PMID:11557558   PMID:11866539   PMID:12064615   PMID:12397213   PMID:12435353   PMID:12477932   PMID:12594044   PMID:14766937   PMID:15044680   PMID:15094345  
PMID:15117819   PMID:15193866   PMID:15297374   PMID:15489334   PMID:16188595   PMID:16189514   PMID:16361362   PMID:16508580   PMID:16545451   PMID:16600287   PMID:16646598   PMID:16710414  
PMID:16814413   PMID:17189315   PMID:17546509   PMID:17922338   PMID:19490996   PMID:19494781   PMID:19808665   PMID:19913121   PMID:20125193   PMID:20530971   PMID:20606116   PMID:20628086  
PMID:20650941   PMID:20818502   PMID:20831043   PMID:21076161   PMID:21348049   PMID:21357845   PMID:21424225   PMID:21649591   PMID:21873635   PMID:21988832   PMID:22021330   PMID:22247482  
PMID:22405441   PMID:22422398   PMID:22423256   PMID:22713807   PMID:23040431   PMID:23134779   PMID:23292621   PMID:23348765   PMID:23579271   PMID:23819010   PMID:24060583   PMID:24626989  
PMID:24656738   PMID:24722188   PMID:24733048   PMID:24973497   PMID:25200600   PMID:25583071   PMID:25992486   PMID:26625713   PMID:26634538   PMID:26821948   PMID:27813566   PMID:27826129  
PMID:28577096   PMID:28947768   PMID:28969560   PMID:29351227   PMID:29587382   PMID:30594539   PMID:30639242   PMID:31270966   PMID:32272685   PMID:32296183   PMID:32814053   PMID:33518654  


Genomics

Comparative Map Data
GJA5
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 Ensembl1147,756,199 - 147,773,362 (-)EnsemblGRCh38hg38GRCh38
GRCh381147,756,199 - 147,781,127 (-)NCBIGRCh38GRCh38hg38GRCh38
GRCh371147,228,332 - 147,245,455 (-)NCBIGRCh37GRCh37hg19GRCh37
Build 361145,694,956 - 145,712,108 (-)NCBINCBI36hg18NCBI36
Build 341144,453,708 - 144,457,501NCBI
Celera1121,738,476 - 121,755,641 (+)NCBI
Cytogenetic Map1q21.2NCBI
HuRef1120,641,850 - 120,658,997 (-)NCBIHuRef
CHM1_11149,124,325 - 149,141,488 (-)NCBICHM1_1
Gja5
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39396,939,718 - 96,960,950 (+)NCBIGRCm39mm39
GRCm39 Ensembl396,812,009 - 96,984,732 (+)Ensembl
GRCm38397,032,402 - 97,053,634 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 Ensembl396,904,693 - 97,077,416 (+)EnsemblGRCm38mm10GRCm38
MGSCv37396,836,339 - 96,857,557 (+)NCBIGRCm37mm9NCBIm37
MGSCv36397,117,821 - 97,139,039 (+)NCBImm8
Celera398,439,607 - 98,460,828 (+)NCBICelera
Cytogenetic Map3F2.1NCBI
cM Map342.04NCBI
Gja5
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.22184,602,407 - 184,621,952 (+)NCBImRatBN7.2
mRatBN7.2 Ensembl2184,564,475 - 184,621,952 (+)Ensembl
Rnor_6.02199,162,745 - 199,184,942 (+)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_6.0 Ensembl2199,162,745 - 199,184,939 (+)EnsemblRnor6.0rn6Rnor6.0
Rnor_5.02218,648,368 - 218,669,354 (+)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.42191,824,118 - 191,843,867 (+)NCBIRGSC3.4rn4RGSC3.4
RGSC_v3.12191,786,871 - 191,806,619 (+)NCBI
Celera2177,098,223 - 177,117,685 (+)NCBICelera
Cytogenetic Map2q34NCBI
Gja5
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_004955568635,042 - 653,349 (+)EnsemblChiLan1.0
ChiLan1.0NW_004955568635,319 - 652,692 (+)NCBIChiLan1.0ChiLan1.0
GJA5
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.11112,306,880 - 112,331,358 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 Ensembl1112,328,337 - 112,329,413 (+)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v01123,200,111 - 123,224,626 (-)NCBIMhudiblu_PPA_v0panPan3
GJA5
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.11758,289,327 - 58,305,315 (-)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 Ensembl1758,289,327 - 58,305,315 (-)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_Tasha1757,757,715 - 57,773,685 (-)NCBI
ROS_Cfam_1.01759,286,062 - 59,301,971 (-)NCBI
UMICH_Zoey_3.11758,159,018 - 58,175,010 (-)NCBI
UNSW_CanFamBas_1.01758,219,654 - 58,235,621 (-)NCBI
UU_Cfam_GSD_1.01758,946,248 - 58,962,243 (-)NCBI
Gja5
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2NW_02440505820,393,289 - 20,403,471 (-)NCBI
SpeTri2.0NW_004936867269,477 - 279,549 (-)NCBISpeTri2.0SpeTri2.0SpeTri2.0
GJA5
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1 Ensembl499,854,392 - 99,871,288 (+)EnsemblSscrofa11.1susScr11Sscrofa11.1
Sscrofa11.1499,854,129 - 99,871,288 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.24109,687,517 - 109,704,699 (+)NCBISscrofa10.2Sscrofa10.2susScr3
GJA5
(Chlorocebus sabaeus - green monkey)
Green Monkey AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Vero_WHO_p1.0NW_02366603814,460,790 - 14,478,590 (+)NCBIVero_WHO_p1.0
Gja5
(Heterocephalus glaber - naked mole-rat)
Naked Mole-rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_00462477216,810,723 - 16,828,328 (-)NCBIHetGla_female_1.0hetGla2

Position Markers
RH71190  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371147,230,319 - 147,230,450UniSTSGRCh37
Build 361145,696,943 - 145,697,074RGDNCBI36
Celera1121,753,523 - 121,753,654RGD
Cytogenetic Map1q21.1UniSTS
HuRef1120,643,837 - 120,643,968UniSTS
GeneMap99-GB4 RH Map1536.74UniSTS
RH69491  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371147,229,357 - 147,229,481UniSTSGRCh37
Build 361145,695,981 - 145,696,105RGDNCBI36
Celera1121,754,492 - 121,754,616RGD
Cytogenetic Map1q21.1UniSTS
HuRef1120,642,875 - 120,642,999UniSTS
GeneMap99-GB4 RH Map1536.8UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:1774
Count of miRNA genes:767
Interacting mature miRNAs:891
Transcripts:ENST00000271348, ENST00000369237, ENST00000430508
Prediction methods:Miranda, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component
High
Medium 362 1608 260 2 74 1 1119 241 148 92 215 769 2 813 786 4
Low 1877 636 886 301 403 147 2918 1854 2576 50 969 513 159 391 1882 2
Below cutoff 43 500 313 118 536 116 254 74 895 7 50 42 9 1 120

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_009369 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_005266 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_181703 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_005272951 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_017001044 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC241644 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF074995 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AF151979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AH012475 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL365260 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC013313 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BM970701 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BQ231177 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BQ924948 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BT019415 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BT019416 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX377692 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471223 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DR003194 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KJ534844 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  L34954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U03486 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000430508   ⟹   ENSP00000407645
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1147,758,484 - 147,773,354 (-)Ensembl
RefSeq Acc Id: ENST00000579774   ⟹   ENSP00000463851
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1147,756,199 - 147,760,602 (-)Ensembl
RefSeq Acc Id: ENST00000621517   ⟹   ENSP00000484552
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 Ensembl1147,756,200 - 147,773,362 (-)Ensembl
RefSeq Acc Id: NM_005266   ⟹   NP_005257
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,756,199 - 147,773,351 (-)NCBI
GRCh371147,228,332 - 147,253,165 (-)NCBI
Build 361145,694,956 - 145,712,108 (-)NCBI Archive
HuRef1120,641,850 - 120,658,997 (-)NCBI
CHM1_11149,124,325 - 149,141,488 (-)NCBI
Sequence:
RefSeq Acc Id: NM_181703   ⟹   NP_859054
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,756,199 - 147,760,602 (-)NCBI
GRCh371147,228,332 - 147,253,165 (-)NCBI
Build 361145,694,956 - 145,699,338 (-)NCBI Archive
HuRef1120,641,850 - 120,658,997 (-)NCBI
CHM1_11149,124,325 - 149,128,732 (-)NCBI
Sequence:
RefSeq Acc Id: XM_005272951   ⟹   XP_005273008
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,756,199 - 147,781,127 (-)NCBI
GRCh371147,228,332 - 147,253,165 (-)NCBI
Sequence:
RefSeq Acc Id: XM_017001044   ⟹   XP_016856533
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,756,199 - 147,773,415 (-)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_005257   ⟸   NM_005266
- UniProtKB: P36382 (UniProtKB/Swiss-Prot),   X5D2H9 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_859054   ⟸   NM_181703
- UniProtKB: P36382 (UniProtKB/Swiss-Prot),   X5D2H9 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: XP_005273008   ⟸   XM_005272951
- Peptide Label: isoform X1
- UniProtKB: P36382 (UniProtKB/Swiss-Prot),   X5D2H9 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: XP_016856533   ⟸   XM_017001044
- Peptide Label: isoform X1
- UniProtKB: P36382 (UniProtKB/Swiss-Prot),   X5D2H9 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: ENSP00000484552   ⟸   ENST00000621517
RefSeq Acc Id: ENSP00000407645   ⟸   ENST00000430508
RefSeq Acc Id: ENSP00000463851   ⟸   ENST00000579774
Protein Domains
CNX   Connexin_CCC

Promoters
RGD ID:6856882
Promoter ID:EPDNEW_H1606
Type:initiation region
Name:GJA5_1
Description:gap junction protein alpha 5
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H1608  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,760,599 - 147,760,659EPDNEW
RGD ID:6856886
Promoter ID:EPDNEW_H1608
Type:multiple initiation site
Name:GJA5_2
Description:gap junction protein alpha 5
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H1606  
Experiment Methods:Single-end sequencing.; Paired-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh381147,781,052 - 147,781,112EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
NM_181703.4(GJA5):c.145C>T (p.Gln49Ter) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000022512] Chr1:147759094 [GRCh38]
Chr1:147231202 [GRCh37]
Chr1:1q21.2
pathogenic
NM_181703.4(GJA5):c.253G>A (p.Val85Ile) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000022513] Chr1:147758986 [GRCh38]
Chr1:147231094 [GRCh37]
Chr1:1q21.2
pathogenic
NM_181703.4(GJA5):c.661C>A (p.Leu221Ile) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000022514] Chr1:147758578 [GRCh38]
Chr1:147230686 [GRCh37]
Chr1:1q21.2
pathogenic
NM_181703.4(GJA5):c.262C>T (p.Pro88Ser) single nucleotide variant Atrial fibrillation, somatic [RCV000018522] Chr1:147758977 [GRCh38]
Chr1:147231085 [GRCh37]
Chr1:1q21.2
pathogenic|other
NM_181703.4(GJA5):c.286G>T (p.Ala96Ser) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000018521]|Atrial standstill 1 [RCV001063672]|not provided [RCV000487058] Chr1:147758953 [GRCh38]
Chr1:147231061 [GRCh37]
Chr1:1q21.2
pathogenic|likely pathogenic|uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146618988-147824207) copy number gain Optic atrophy [RCV000626498] Chr1:146618988..147824207 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.685C>A (p.Leu229Met) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000022515] Chr1:147758554 [GRCh38]
Chr1:147230662 [GRCh37]
Chr1:1q21.2
pathogenic
NM_181703.4(GJA5):c.223A>T (p.Ile75Phe) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000114757] Chr1:147759016 [GRCh38]
Chr1:147231124 [GRCh37]
Chr1:1q21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147035964-148359881)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050346]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050346]|See cases [RCV000050346] Chr1:147035964..148359881 [GRCh38]
Chr1:146507518..147909094 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss See cases [RCV000050278] Chr1:145215697..149076087 [GRCh38]
Chr1:145987156..148545520 [GRCh37]
Chr1:144698513..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.2(chr1:147756734-147776466)x3 copy number gain See cases [RCV000050299] Chr1:147756734..147776466 [GRCh38]
Chr1:147228867..147248577 [GRCh37]
Chr1:145695491..145715201 [NCBI36]
Chr1:1q21.2
uncertain significance
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000050868] Chr1:145215697..149076087 [GRCh38]
Chr1:145799543..148545520 [GRCh37]
Chr1:144510900..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148234205)x3 copy number gain See cases [RCV000050917] Chr1:146987841..148234205 [GRCh38]
Chr1:145987156..147411593 [GRCh37]
Chr1:144698513..145878217 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x3 copy number gain See cases [RCV000050515] Chr1:146987841..148436984 [GRCh38]
Chr1:145425395..147909094 [GRCh37]
Chr1:144136752..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|uncertain significance|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145439580-148359881)x1 copy number loss See cases [RCV000050516] Chr1:145439580..148359881 [GRCh38]
Chr1:145425395..147909094 [GRCh37]
Chr1:144136752..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|uncertain significance|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000050688] Chr1:145215697..149076087 [GRCh38]
Chr1:146143189..148545520 [GRCh37]
Chr1:144854546..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145232830-148587578)x1 copy number loss Global developmental delay [RCV000050689]|See cases [RCV000050689] Chr1:145232830..148587578 [GRCh38]
Chr1:146143189..148545520 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146354110-148503773)x1 copy number loss See cases [RCV000050634] Chr1:146354110..148503773 [GRCh38]
Chr1:146143189..149699420 [GRCh37]
Chr1:144854546..147966044 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1p11.2-q22(chr1:120836007-149583533)x3 copy number gain See cases [RCV000051109] Chr1:120836007..149583533 [GRCh38]
Chr1:145451329..156102366 [GRCh37]
Chr1:144162686..154368990 [NCBI36]
Chr1:1p11.2-q22
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148359881)x3 copy number gain See cases [RCV000051058] Chr1:146987841..148359881 [GRCh38]
Chr1:145987156..147909094 [GRCh37]
Chr1:144698513..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148359881)x1 copy number loss Nonsyndromic microcephaly [RCV000051059]|Expressive language delay [RCV000051060]|Global developmental delay [RCV000051061]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051062]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051062]|See cases [RCV000051059] Chr1:146987841..148359881 [GRCh38]
Chr1:145987156..147909094 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1p12-q21.2(chr1:120836007-149583533)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051844]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051844]|See cases [RCV000051844] Chr1:120836007..149583533 [GRCh38]
Chr1:145425395..153212501 [GRCh37]
Chr1:144136752..151479125 [NCBI36]
Chr1:1p12-q21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148437125)x1 copy number loss See cases [RCV000052252] Chr1:146987841..148437125 [GRCh38]
Chr1:145986956..147909235 [GRCh37]
Chr1:144698313..146375859 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436925)x1 copy number loss See cases [RCV000052262] Chr1:146987841..148436925 [GRCh38]
Chr1:145987156..147909035 [GRCh37]
Chr1:144698513..146375659 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148328747)x1 copy number loss See cases [RCV000052264] Chr1:146987841..148328747 [GRCh38]
Chr1:146079197..147800872 [GRCh37]
Chr1:144790554..146267496 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148328747)x1 copy number loss See cases [RCV000052267] Chr1:146987841..148328747 [GRCh38]
Chr1:146083024..147800872 [GRCh37]
Chr1:144794381..146267496 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148444397)x1 copy number loss See cases [RCV000052269] Chr1:146987841..148444397 [GRCh38]
Chr1:146096433..147916499 [GRCh37]
Chr1:144807790..146383123 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148234205)x1 copy number loss See cases [RCV000052271] Chr1:146987841..148234205 [GRCh38]
Chr1:146096433..147400685 [GRCh37]
Chr1:144807790..145867309 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148328747)x1 copy number loss See cases [RCV000052272] Chr1:146987841..148328747 [GRCh38]
Chr1:146096433..147800872 [GRCh37]
Chr1:144807790..146267496 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148437125)x3 copy number gain See cases [RCV000052276] Chr1:146987841..148437125 [GRCh38]
Chr1:146142989..147909235 [GRCh37]
Chr1:144854346..146375859 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148437125)x1 copy number loss See cases [RCV000052277] Chr1:146987841..148437125 [GRCh38]
Chr1:146142989..147909235 [GRCh37]
Chr1:144854346..146375859 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148359881)x3 copy number gain See cases [RCV000052282] Chr1:146987841..148359881 [GRCh38]
Chr1:146143189..147909094 [GRCh37]
Chr1:144854546..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000052283] Chr1:146987841..148436984 [GRCh38]
Chr1:146143189..147909094 [GRCh37]
Chr1:144854546..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052297]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052297]|See cases [RCV000052297] Chr1:145215697..149076087 [GRCh38]
Chr1:146143189..148545535 [GRCh37]
Chr1:144854546..146812159 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-148534530)x1 copy number loss See cases [RCV000052244] Chr1:145215697..148534530 [GRCh38]
Chr1:145451329..148309094 [GRCh37]
Chr1:144162686..146675718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148437125)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052245]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052245]|See cases [RCV000052245] Chr1:146987841..148437125 [GRCh38]
Chr1:145655792..147909235 [GRCh37]
Chr1:144367149..146375859 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000052247] Chr1:146987841..148436984 [GRCh38]
Chr1:145655992..147909094 [GRCh37]
Chr1:144367349..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|uncertain significance|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149076087)x1 copy number loss See cases [RCV000052248] Chr1:143515074..149076087 [GRCh38]
Chr1:145655992..149232481 [GRCh37]
Chr1:144367349..147499105 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147029419-148167468)x1 copy number loss See cases [RCV000052299] Chr1:147029419..148167468 [GRCh38]
Chr1:146500972..147711813 [GRCh37]
Chr1:144967596..146178437 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147029419-148342687)x1 copy number loss See cases [RCV000052303] Chr1:147029419..148342687 [GRCh38]
Chr1:146500972..147814815 [GRCh37]
Chr1:144967596..146281439 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147093177-148262736)x1 copy number loss See cases [RCV000052306] Chr1:147093177..148262736 [GRCh38]
Chr1:146564743..147735011 [GRCh37]
Chr1:145031367..146201635 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053171]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053171]|See cases [RCV000053171]|See cases [RCV000509068] Chr1:145215697..149076087 [GRCh38]
Chr1:145425395..148545520 [GRCh37]
Chr1:144136752..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|conflicting data from submitters
GRCh37/hg19 1q21.1-21.2(chr1:145425395-148867610)x4 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053172]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053172]|See cases [RCV000053172] Chr1:145425395..148867610 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x4 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053173]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053173]|See cases [RCV000053173] Chr1:144572470..149076087 [GRCh38]
Chr1:145425395..148936712 [GRCh37]
Chr1:144136752..147203336 [NCBI36]
Chr1:1q21.1-21.2
uncertain significance
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x3 copy number gain See cases [RCV000053185] Chr1:144572470..149076087 [GRCh38]
Chr1:145746912..148752268 [GRCh37]
Chr1:144458269..147018892 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148492647)x3 copy number gain See cases [RCV000053186] Chr1:146987841..148492647 [GRCh38]
Chr1:145764367..147988684 [GRCh37]
Chr1:144475724..146455308 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x3 copy number gain See cases [RCV000053187] Chr1:144572470..149076087 [GRCh38]
Chr1:145764368..148752268 [GRCh37]
Chr1:144475725..147018892 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000053191] Chr1:145215697..149076087 [GRCh38]
Chr1:145764368..148346383 [GRCh37]
Chr1:144475725..146713007 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148287692)x3 copy number gain See cases [RCV000053192] Chr1:146987841..148287692 [GRCh38]
Chr1:146083023..147759798 [GRCh37]
Chr1:144794380..146226422 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148444397)x3 copy number gain See cases [RCV000053193] Chr1:146987841..148444397 [GRCh38]
Chr1:146083024..147916499 [GRCh37]
Chr1:144794381..146383123 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000053203] Chr1:145215697..149076087 [GRCh38]
Chr1:146142989..148545676 [GRCh37]
Chr1:144854346..146812300 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147055789-148328747)x3 copy number gain See cases [RCV000053204] Chr1:147055789..148328747 [GRCh38]
Chr1:146527351..147800872 [GRCh37]
Chr1:144993975..146267496 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147099720-148273480)x3 copy number gain See cases [RCV000053205] Chr1:147099720..148273480 [GRCh38]
Chr1:146571304..147745610 [GRCh37]
Chr1:145037928..146212234 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147099720-148436984)x3 copy number gain See cases [RCV000053206] Chr1:147099720..148436984 [GRCh38]
Chr1:146571304..147909094 [GRCh37]
Chr1:145037928..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|uncertain significance|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:145215697-148492647)x3 copy number gain See cases [RCV000053170] Chr1:145215697..148492647 [GRCh38]
Chr1:145388356..148216139 [GRCh37]
Chr1:144099713..146582763 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148437125)x1 copy number loss See cases [RCV000053743] Chr1:146987841..148437125 [GRCh38]
Chr1:145425195..147909235 [GRCh37]
Chr1:144136552..146375859 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:143646745-148752268)x1 copy number loss See cases [RCV000053699] Chr1:143646745..148752268 [GRCh37]
Chr1:142438268..147018892 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-149343657)x1 copy number loss See cases [RCV000053725] Chr1:146987841..149343657 [GRCh38]
Chr1:144912271..147814815 [GRCh37]
Chr1:143623628..146281439 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:143721526-149232481)x1 copy number loss See cases [RCV000053700] Chr1:143721526..149232481 [GRCh37]
Chr1:142513049..147499105 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000051059] Chr1:146987841..148436984 [GRCh38]
Chr1:145987156..147909094 [GRCh37]
Chr1:144698513..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143965076-149471555)x3 copy number gain See cases [RCV000051832] Chr1:143965076..149471555 [GRCh38]
Chr1:119457515..121050554 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146500972-147851297) copy number loss Aicardi syndrome [RCV001291972] Chr1:146500972..147851297 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147035964-148436984)x1 copy number loss See cases [RCV000133790] Chr1:147035964..148436984 [GRCh38]
Chr1:146507518..147909094 [GRCh37]
Chr1:144974142..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147035964-148436984)x3 copy number gain See cases [RCV000050346] Chr1:147035964..148436984 [GRCh38]
Chr1:146507518..147909094 [GRCh37]
Chr1:144974142..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss See cases [RCV000050689] Chr1:145215697..149076087 [GRCh38]
Chr1:146143189..148545520 [GRCh37]
Chr1:144854546..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145232830-148587578)x3 copy number gain See cases [RCV000133640] Chr1:145232830..148587578 [GRCh38]
Chr1:145987156..148545520 [GRCh37]
Chr1:144698513..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x4 copy number gain See cases [RCV000053172] Chr1:144572470..149076087 [GRCh38]
Chr1:145425395..148867610 [GRCh37]
Chr1:144136752..147134234 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148234205)x1 copy number loss See cases [RCV000052242] Chr1:146987841..148234205 [GRCh38]
Chr1:145425395..146507577 [GRCh37]
Chr1:144136752..144974201 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146354110-148503773)x1 copy number loss See cases [RCV000134191] Chr1:146354110..148503773 [GRCh38]
Chr1:145388355..149418924 [GRCh37]
Chr1:144099712..147685548 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000134219] Chr1:146964168..148572213 [GRCh38]
Chr1:146038914..147838700 [GRCh37]
Chr1:144750271..146305324 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147035964-148352079)x3 copy number gain See cases [RCV000133957] Chr1:147035964..148352079 [GRCh38]
Chr1:146507518..147824207 [GRCh37]
Chr1:144974142..146290831 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148415560)x3 copy number gain See cases [RCV000134089] Chr1:146987841..148415560 [GRCh38]
Chr1:145899359..147887713 [GRCh37]
Chr1:144610716..146354337 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145601946-148572213)x1 copy number loss See cases [RCV000135335] Chr1:145601946..148572213 [GRCh38]
Chr1:145311043..147915048 [GRCh37]
Chr1:144022400..146381672 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146355224-148494171)x3 copy number gain See cases [RCV000135345] Chr1:146355224..148494171 [GRCh38]
Chr1:145899339..148782879 [GRCh37]
Chr1:144610696..147049503 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145338382-148599763)x3 copy number gain See cases [RCV000135353] Chr1:145338382..148599763 [GRCh38]
Chr1:145271815..148254822 [GRCh37]
Chr1:143983172..146621446 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145425395-148867610)x3 copy number gain See cases [RCV000135740] Chr1:145425395..148867610 [GRCh37]
Chr1:144136752..147134234 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145425395-148867610)x1 copy number loss See cases [RCV000135741] Chr1:145425395..148867610 [GRCh37]
Chr1:144136752..147134234 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147029419-148355961)x3 copy number gain See cases [RCV000135684] Chr1:147029419..148355961 [GRCh38]
Chr1:146500972..147828089 [GRCh37]
Chr1:144967596..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148359881)x4 copy number gain See cases [RCV000135513] Chr1:146987841..148359881 [GRCh38]
Chr1:145987156..147909094 [GRCh37]
Chr1:144698513..146375718 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic|uncertain significance
GRCh38/hg38 1q21.2(chr1:147756534-147776607)x3 copy number gain See cases [RCV000135424] Chr1:147756534..147776607 [GRCh38]
Chr1:147228667..147248718 [GRCh37]
Chr1:145695291..145715342 [NCBI36]
Chr1:1q21.2
benign
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000135484] Chr1:146964168..148572213 [GRCh38]
Chr1:146074031..147834140 [GRCh37]
Chr1:144785388..146300764 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146355224-148503773)x3 copy number gain See cases [RCV000136532] Chr1:146355224..148503773 [GRCh38]
Chr1:145425395..149768855 [GRCh37]
Chr1:144136752..148035479 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic|uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:142618650-148535229)x3 copy number gain See cases [RCV000135936] Chr1:142618650..148535229 [GRCh37]
Chr1:141560173..146801853 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely benign
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x3 copy number gain See cases [RCV000136047] Chr1:144572470..149076087 [GRCh38]
Chr1:145799556..148867640 [GRCh37]
Chr1:144510913..147134264 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149076087)x3 copy number gain See cases [RCV000136866] Chr1:143515074..149076087 [GRCh38]
Chr1:145425395..149091187 [GRCh37]
Chr1:144136752..147357811 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147335698-147909284)x3 copy number gain See cases [RCV000136720] Chr1:147335698..147909284 [GRCh38]
Chr1:146807433..147381411 [GRCh37]
Chr1:145274057..145848035 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x3 copy number gain See cases [RCV000137646] Chr1:144572470..149076087 [GRCh38]
Chr1:145788863..148809863 [GRCh37]
Chr1:144500220..147076487 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000137559] Chr1:145215697..149076087 [GRCh38]
Chr1:146053414..148535229 [GRCh37]
Chr1:144764771..146801853 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149076087)x1 copy number loss See cases [RCV000137435] Chr1:143515074..149076087 [GRCh38]
Chr1:145626237..149244468 [GRCh37]
Chr1:144337594..147511092 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148355961)x1 copy number loss See cases [RCV000137526] Chr1:146987841..148355961 [GRCh38]
Chr1:145655992..147828089 [GRCh37]
Chr1:144367349..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148355961)x1 copy number loss See cases [RCV000137600] Chr1:146987841..148355961 [GRCh38]
Chr1:145804679..147828089 [GRCh37]
Chr1:144516036..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148234205)x1 copy number loss See cases [RCV000137231] Chr1:146987841..148234205 [GRCh38]
Chr1:146143189..147721869 [GRCh37]
Chr1:144854546..146188493 [NCBI36]
Chr1:1q21.1-21.2
uncertain significance
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148355961)x1 copy number loss See cases [RCV000138054] Chr1:146987841..148355961 [GRCh38]
Chr1:146053414..147828089 [GRCh37]
Chr1:144764771..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147029419-148352079)x3 copy number gain See cases [RCV000137889] Chr1:147029419..148352079 [GRCh38]
Chr1:146500972..147824207 [GRCh37]
Chr1:144967596..146290831 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147002657-148355961)x1 copy number loss See cases [RCV000137764] Chr1:147002657..148355961 [GRCh38]
Chr1:146474216..147828089 [GRCh37]
Chr1:144940840..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147071299-148355961)x1 copy number loss See cases [RCV000137947] Chr1:147071299..148355961 [GRCh38]
Chr1:146542843..147828089 [GRCh37]
Chr1:145009467..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148355961)x1 copy number loss See cases [RCV000138893] Chr1:146987841..148355961 [GRCh38]
Chr1:145723321..147828089 [GRCh37]
Chr1:144434678..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146354110-148494217)x1 copy number loss See cases [RCV000138709] Chr1:146354110..148494217 [GRCh38]
Chr1:145626237..149453964 [GRCh37]
Chr1:144337594..147720588 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147036093-148352084)x3 copy number gain See cases [RCV000138851] Chr1:147036093..148352084 [GRCh38]
Chr1:146507649..147824212 [GRCh37]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:147156522-148352084)x3 copy number gain See cases [RCV000138854] Chr1:147156522..148352084 [GRCh38]
Chr1:146628101..147824212 [GRCh37]
Chr1:145094725..146290836 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x4 copy number gain See cases [RCV000138438] Chr1:145215697..149076087 [GRCh38]
Chr1:146500972..148535229 [GRCh37]
Chr1:144967596..146801853 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148352084)x1 copy number loss See cases [RCV000138516] Chr1:146987841..148352084 [GRCh38]
Chr1:145415156..147824212 [GRCh37]
Chr1:144126513..146290836 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148352084)x3 copy number gain See cases [RCV000138637] Chr1:146987841..148352084 [GRCh38]
Chr1:145799556..147824212 [GRCh37]
Chr1:144510913..146290836 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145232830-148587578)x3 copy number gain See cases [RCV000138437] Chr1:145232830..148587578 [GRCh38]
Chr1:146500972..148535229 [GRCh37]
Chr1:144967596..146801853 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:147036155-147945622)x1 copy number loss See cases [RCV000139330] Chr1:147036155..147945622 [GRCh38]
Chr1:146507711..147417736 [GRCh37]
Chr1:144974335..145884360 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.2(chr1:147756263-147836927)x3 copy number gain See cases [RCV000139144] Chr1:147756263..147836927 [GRCh38]
Chr1:147228396..147309062 [GRCh37]
Chr1:145695020..145775686 [NCBI36]
Chr1:1q21.2
conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000139942] Chr1:146964168..148572213 [GRCh38]
Chr1:146105170..147830830 [GRCh37]
Chr1:144816527..146297454 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145751815-148000664)x3 copy number gain See cases [RCV000140155] Chr1:145751815..148000664 [GRCh37]
Chr1:144463172..146467288 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149563337)x1 copy number loss See cases [RCV000139762] Chr1:143515074..149563337 [GRCh38]
Chr1:145415156..149433207 [GRCh37]
Chr1:144126513..147699831 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145601946-148572213)x1 copy number loss See cases [RCV000141206] Chr1:145601946..148572213 [GRCh38]
Chr1:145376675..147860552 [GRCh37]
Chr1:144088032..146327176 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000141344] Chr1:146964168..148572213 [GRCh38]
Chr1:146053414..147860552 [GRCh37]
Chr1:144764771..146327176 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000140902] Chr1:146964168..148572213 [GRCh38]
Chr1:145932455..147385641 [GRCh37]
Chr1:144643812..145852265 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145415190-148809863)x3 copy number gain See cases [RCV000140695] Chr1:145415190..148809863 [GRCh37]
Chr1:144126547..147076487 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic|conflicting data from submitters
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x1 copy number loss See cases [RCV000140697] Chr1:144572470..149076087 [GRCh38]
Chr1:145415190..148809863 [GRCh37]
Chr1:144126547..147076487 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000141896] Chr1:146964168..148572213 [GRCh38]
Chr1:146101790..147830830 [GRCh37]
Chr1:144813147..146297454 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000141980] Chr1:146964168..148572213 [GRCh38]
Chr1:146043713..147844758 [GRCh37]
Chr1:144755070..146311382 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-148016122)x1 copy number loss See cases [RCV000141747] Chr1:146105170..148016122 [GRCh37]
Chr1:144816527..146482746 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149076087)x1 copy number loss See cases [RCV000141560] Chr1:143515074..149076087 [GRCh38]
Chr1:145747242..149155026 [GRCh37]
Chr1:144458599..147421650 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:144572470-149076087)x1 copy number loss See cases [RCV000141565] Chr1:144572470..149076087 [GRCh38]
Chr1:146500972..148809863 [GRCh37]
Chr1:144967596..147076487 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145888925-148020200)x1 copy number loss See cases [RCV000141688] Chr1:145888925..148020200 [GRCh37]
Chr1:144600282..146486824 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147036093-147909352)x1 copy number loss See cases [RCV000142425] Chr1:147036093..147909352 [GRCh38]
Chr1:146507649..147381479 [GRCh37]
Chr1:144974273..145848103 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss See cases [RCV000142480] Chr1:145215697..149076087 [GRCh38]
Chr1:146507649..148545664 [GRCh37]
Chr1:144974273..146812288 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146354110-148503773)x3 copy number gain See cases [RCV000142509] Chr1:146354110..148503773 [GRCh38]
Chr1:145425395..149699420 [GRCh37]
Chr1:144136752..147966044 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss See cases [RCV000142511] Chr1:145215697..149076087 [GRCh38]
Chr1:145655992..148545520 [GRCh37]
Chr1:144367349..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000142212] Chr1:146964168..148572213 [GRCh38]
Chr1:146096701..147832190 [GRCh37]
Chr1:144808058..146298814 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000142030] Chr1:146964168..148572213 [GRCh38]
Chr1:146101790..147897962 [GRCh37]
Chr1:144813147..146364586 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147031738-149087283)x3 copy number gain See cases [RCV000142100] Chr1:147031738..149087283 [GRCh38]
Chr1:146503291..147830830 [GRCh37]
Chr1:144969915..146297454 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147016574-149087283)x3 copy number gain See cases [RCV000142102] Chr1:147016574..149087283 [GRCh38]
Chr1:146488131..147995251 [GRCh37]
Chr1:144954755..146461875 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147031738-149087283)x3 copy number gain See cases [RCV000142150] Chr1:147031738..149087283 [GRCh38]
Chr1:146503291..147819294 [GRCh37]
Chr1:144969915..146285918 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.2(chr1:147773472-148355961)x3 copy number gain See cases [RCV000143021] Chr1:147773472..148355961 [GRCh38]
Chr1:147245576..147828089 [GRCh37]
Chr1:145712200..146294713 [NCBI36]
Chr1:1q21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147054748-148355961)x3 copy number gain See cases [RCV000142921] Chr1:147054748..148355961 [GRCh38]
Chr1:146526310..147828089 [GRCh37]
Chr1:144992934..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000142804] Chr1:145215697..149076087 [GRCh38]
Chr1:146526310..148535229 [GRCh37]
Chr1:144992934..146801853 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147029419-148355961)x1 copy number loss See cases [RCV000142561] Chr1:147029419..148355961 [GRCh38]
Chr1:146500972..147828089 [GRCh37]
Chr1:144967596..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000142666] Chr1:145215697..149076087 [GRCh38]
Chr1:146571304..148545520 [GRCh37]
Chr1:145037928..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148355961)x1 copy number loss See cases [RCV000142798] Chr1:146987841..148355961 [GRCh38]
Chr1:145626237..147828089 [GRCh37]
Chr1:144337594..146294713 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147026741-149087283)x3 copy number gain See cases [RCV000143372] Chr1:147026741..149087283 [GRCh38]
Chr1:146498298..147828510 [GRCh37]
Chr1:144964922..146295134 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000143304] Chr1:146964168..148572213 [GRCh38]
Chr1:146145424..147929323 [GRCh37]
Chr1:144856781..146395947 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000143128] Chr1:146964168..148572213 [GRCh38]
Chr1:145886339..147926347 [GRCh37]
Chr1:144597696..146392971 [NCBI36]
Chr1:1q21.1-21.2
pathogenic|likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147099720-148436984)x3 copy number gain See cases [RCV000148082] Chr1:147099720..148436984 [GRCh38]
Chr1:146571304..147909094 [GRCh37]
Chr1:145037928..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:147031738-149087283)x3 copy number gain See cases [RCV000143769] Chr1:147031738..149087283 [GRCh38]
Chr1:146503291..147819815 [GRCh37]
Chr1:144969915..146286439 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x3 copy number gain See cases [RCV000148050] Chr1:146987841..148436984 [GRCh38]
Chr1:145425395..147909094 [GRCh37]
Chr1:144136752..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000148051]|See cases [RCV000509064] Chr1:146987841..148436984 [GRCh38]
Chr1:145655992..147909094 [GRCh37]
Chr1:144367349..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:143515074-149076087)x1 copy number loss See cases [RCV000148052] Chr1:143515074..149076087 [GRCh38]
Chr1:145655992..149232481 [GRCh37]
Chr1:144367349..147499105 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x3 copy number gain See cases [RCV000148054] Chr1:146987841..148436984 [GRCh38]
Chr1:145987156..147909094 [GRCh37]
Chr1:144698513..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000143745] Chr1:146964168..148572213 [GRCh38]
Chr1:146105170..147929323 [GRCh37]
Chr1:144816527..146395947 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x3 copy number gain See cases [RCV000148055] Chr1:146987841..148436984 [GRCh38]
Chr1:146143189..147909094 [GRCh37]
Chr1:144854546..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000148057] Chr1:146987841..148436984 [GRCh38]
Chr1:146143189..147909094 [GRCh37]
Chr1:144854546..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146999330-149087283)x4 copy number gain See cases [RCV000143488] Chr1:146999330..149087283 [GRCh38]
Chr1:146470888..147830903 [GRCh37]
Chr1:144937512..146297527 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000143533] Chr1:146964168..148572213 [GRCh38]
Chr1:145895747..147831170 [GRCh37]
Chr1:144607104..146297794 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000143646] Chr1:146964168..148572213 [GRCh38]
Chr1:146043713..147830830 [GRCh37]
Chr1:144755070..146297454 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145885646-147978640)x3 copy number gain See cases [RCV000143585] Chr1:145885646..147978640 [GRCh37]
Chr1:144597003..146445264 [NCBI36]
Chr1:1q21.1-21.2
likely pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x3 copy number gain See cases [RCV000143509] Chr1:146964168..148572213 [GRCh38]
Chr1:145932454..147819294 [GRCh37]
Chr1:144643811..146285918 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146964168-148572213)x1 copy number loss See cases [RCV000143612] Chr1:146964168..148572213 [GRCh38]
Chr1:145888925..147926347 [GRCh37]
Chr1:144600282..146392971 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1(chr1:146987841-148234205)x1 copy number loss See cases [RCV000137606] Chr1:146987841..148234205 [GRCh38]
Chr1:145415190..146474275 [GRCh37]
Chr1:144126547..144940899 [NCBI36]
Chr1:1q21.1
uncertain significance
GRCh38/hg38 1q21.1-21.2(chr1:147093177-148262736)x1 copy number loss See cases [RCV000148155] Chr1:147093177..148262736 [GRCh38]
Chr1:146564743..147735011 [GRCh37]
Chr1:145031367..146201635 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.2(chr1:147756734-147776466)x3 copy number gain See cases [RCV000148235] Chr1:147756734..147776466 [GRCh38]
Chr1:147228867..147248577 [GRCh37]
Chr1:145695491..145715201 [NCBI36]
Chr1:1q21.2
uncertain significance
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x3 copy number gain See cases [RCV000148163] Chr1:145215697..149076087 [GRCh38]
Chr1:146143189..148545520 [GRCh37]
Chr1:144854546..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:146987841-148436984)x1 copy number loss See cases [RCV000148176] Chr1:146987841..148436984 [GRCh38]
Chr1:145425395..147909094 [GRCh37]
Chr1:144136752..146375718 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1-21.2(chr1:145215697-149076087)x1 copy number loss See cases [RCV000148183] Chr1:145215697..149076087 [GRCh38]
Chr1:145987156..148545520 [GRCh37]
Chr1:144698513..146812144 [NCBI36]
Chr1:1q21.1-21.2
pathogenic
GRCh38/hg38 1q21.1(chr1:146987841-148234205)x1 copy number loss See cases [RCV000053734] Chr1:146987841..148234205 [GRCh38]
Chr1:145310254..146491118 [GRCh37]
Chr1:144021611..144957742 [NCBI36]
Chr1:1q21.1
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147380935)x1 copy number loss See cases [RCV000239836] Chr1:146535353..147380935 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.369C>T (p.Tyr123=) single nucleotide variant Atrial standstill 1 [RCV000531807]|Familial atrial fibrillation [RCV000267472]|not provided [RCV001668633]|not specified [RCV001700034] Chr1:147758870 [GRCh38]
Chr1:147230978 [GRCh37]
Chr1:1q21.2
benign|likely benign
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147844809)x1 copy number loss See cases [RCV000239831] Chr1:146535353..147844809 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147867793)x3 copy number gain See cases [RCV000239811] Chr1:146535353..147867793 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147877206)x3 copy number gain See cases [RCV000240235] Chr1:146535353..147877206 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145740598-147825678) copy number gain Chromosome 1q21.1 duplication syndrome [RCV000767826] Chr1:145740598..147825678 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146560564-147416122) copy number loss 1q21.1 recurrent microdeletion [RCV000767693] Chr1:146560564..147416122 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
Single allele duplication Autism spectrum disorder [RCV000225476] Chr1:146499479..147830375 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
Single allele duplication Autism spectrum disorder [RCV000225655] Chr1:146089254..148004783 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.3(chr1:144927578-153223600)x3 copy number gain Chromosome 1q21.1 duplication syndrome [RCV000223957] Chr1:144927578..153223600 [GRCh37]
Chr1:1q21.1-21.3
pathogenic
NM_181703.4(GJA5):c.995G>A (p.Arg332His) single nucleotide variant 1q21.1 recurrent microdeletion [RCV000763745]|Atrial fibrillation, familial, 11 [RCV000359770]|Atrial standstill 1 [RCV000649051] Chr1:147758244 [GRCh38]
Chr1:147230352 [GRCh37]
Chr1:1q21.2
likely benign|uncertain significance
NM_181703.4(GJA5):c.353G>A (p.Arg118Gln) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000324845] Chr1:147758886 [GRCh38]
Chr1:147230994 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147824207)x1 copy number loss See cases [RCV000239854] Chr1:146535353..147824207 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.13A>G (p.Ser5Gly) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000328129] Chr1:147759226 [GRCh38]
Chr1:147231334 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.2(chr1:147111289-147482311)x3 copy number gain See cases [RCV000239904] Chr1:147111289..147482311 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146542843-147857135)x1 copy number loss See cases [RCV000239847] Chr1:146542843..147857135 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:143500223-149763815)x3 copy number gain See cases [RCV000240518] Chr1:143500223..149763815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147857135)x1 copy number loss See cases [RCV000240361] Chr1:146535353..147857135 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_005266.7(GJA5):c.-108G>A single nucleotide variant Atrial fibrillation, familial, 11 [RCV000334290] Chr1:147773326 [GRCh38]
Chr1:147245430 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*508G>A single nucleotide variant Atrial fibrillation, familial, 11 [RCV000399294] Chr1:147757654 [GRCh38]
Chr1:147229762 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_018075.5(ANO10):c.1954A>G (p.Met652Val) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000385093]|not provided [RCV001660561] Chr1:147759265 [GRCh38]
Chr1:147231373 [GRCh37]
Chr1:1q21.2
benign|likely benign
NM_005266.7(GJA5):c.-51G>C single nucleotide variant Atrial fibrillation, familial, 11 [RCV000293140] Chr1:147773269 [GRCh38]
Chr1:147245373 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_005266.7(GJA5):c.-67G>A single nucleotide variant Familial atrial fibrillation [RCV000387823] Chr1:147773285 [GRCh38]
Chr1:147245389 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*608C>T single nucleotide variant Familial atrial fibrillation [RCV000295375] Chr1:147757554 [GRCh38]
Chr1:147229662 [GRCh37]
Chr1:1q21.2
likely benign
NM_005266.7(GJA5):c.-68C>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV000295714] Chr1:147773286 [GRCh38]
Chr1:147245390 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_005266.7(GJA5):c.-61A>G single nucleotide variant Atrial standstill 1 [RCV001522972]|Familial atrial fibrillation [RCV000330907] Chr1:147773279 [GRCh38]
Chr1:147245383 [GRCh37]
Chr1:1q21.2
benign|likely benign
NM_181703.4(GJA5):c.*616T>C single nucleotide variant Atrial fibrillation, familial, 11 [RCV000395760] Chr1:147757546 [GRCh38]
Chr1:147229654 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.334G>C (p.Glu112Gln) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000270784] Chr1:147758905 [GRCh38]
Chr1:147231013 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146506310-147824207)x3 copy number gain not provided [RCV000488100] Chr1:146506310..147824207 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
NM_181703.4(GJA5):c.1068A>G (p.Leu356=) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000302141] Chr1:147758171 [GRCh38]
Chr1:147230279 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.342C>G (p.Ala114=) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000363163] Chr1:147758897 [GRCh38]
Chr1:147231005 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_005266.6(GJA5):c.-175G>A single nucleotide variant Familial atrial fibrillation [RCV000316019] Chr1:147773393 [GRCh38]
Chr1:147245497 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.*1259C>T single nucleotide variant Familial atrial fibrillation [RCV000382080] Chr1:147756903 [GRCh38]
Chr1:147229036 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*617TGGTATGTACCTCTGGCAAATGCCC[3] microsatellite Familial atrial fibrillation [RCV000347287] Chr1:147757495..147757496 [GRCh38]
Chr1:147229619..147229628 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.*46T>C single nucleotide variant Atrial fibrillation, familial, 11 [RCV000407120] Chr1:147758116 [GRCh38]
Chr1:147230224 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*520A>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV000352700] Chr1:147757642 [GRCh38]
Chr1:147229750 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*364C>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV000299075] Chr1:147757798 [GRCh38]
Chr1:147229906 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*1396G>A single nucleotide variant Familial atrial fibrillation [RCV000325178] Chr1:147756766 [GRCh38]
Chr1:147228899 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.*60C>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV000356223] Chr1:147758102 [GRCh38]
Chr1:147230210 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_005266.6(GJA5):c.-152G= single nucleotide variant Familial atrial fibrillation [RCV000277169] Chr1:147773370 [GRCh38]
Chr1:147245474 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.*1211A>G single nucleotide variant Familial atrial fibrillation [RCV000289943] Chr1:147756951 [GRCh38]
Chr1:147229084 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146618988-147825678) copy number loss 1q21.1 recurrent microdeletion [RCV000767660] Chr1:146618988..147825678 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
Single allele deletion 1q21.1 recurrent microdeletion [RCV000414986] Chr1:146560564..147416122 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-147830830)x3 copy number gain See cases [RCV000449268] Chr1:146105170..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-147897962)x1 copy number loss See cases [RCV000449106] Chr1:146105170..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.2(chr1:147238413-147278516)x3 copy number gain See cases [RCV000449228] Chr1:147238413..147278516 [GRCh37]
Chr1:1q21.2
likely benign
GRCh37/hg19 1q21.1-21.2(chr1:146096700-147819294)x3 copy number gain See cases [RCV000446349] Chr1:146096700..147819294 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146043713-147819294)x3 copy number gain See cases [RCV000446850] Chr1:146043713..147819294 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144833672-148870387)x3 copy number gain See cases [RCV000447303] Chr1:144833672..148870387 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145886339-147897962)x1 copy number loss See cases [RCV000447310] Chr1:145886339..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147900955)x3 copy number gain See cases [RCV000446607] Chr1:146535353..147900955 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-147830830)x1 copy number loss See cases [RCV000446851] Chr1:146105170..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.3(chr1:143753740-151399970)x3 copy number gain See cases [RCV000447109] Chr1:143753740..151399970 [GRCh37]
Chr1:1q21.1-21.3
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147867734)x3 copy number gain See cases [RCV000447215] Chr1:146535353..147867734 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-148016122)x1 copy number loss See cases [RCV000446501] Chr1:146105170..148016122 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.2(chr1:147140518-147509544)x3 copy number gain See cases [RCV000446513] Chr1:147140518..147509544 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147857078)x1 copy number loss See cases [RCV000446048] Chr1:146535353..147857078 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146016526-147830830)x3 copy number gain See cases [RCV000447628] Chr1:146016526..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145885645-147947839)x1 copy number loss See cases [RCV000446765] Chr1:145885645..147947839 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146496425-147929323)x3 copy number gain See cases [RCV000447186] Chr1:146496425..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146535353-147877162)x3 copy number gain See cases [RCV000447634] Chr1:146535353..147877162 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145895746-147856007)x1 copy number loss See cases [RCV000445872] Chr1:145895746..147856007 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145895746-147897962)x1 copy number loss See cases [RCV000445777] Chr1:145895746..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146498198-147926347)x3 copy number gain See cases [RCV000448794] Chr1:146498198..147926347 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146127815-147844758)x1 copy number loss See cases [RCV000448648] Chr1:146127815..147844758 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146507518-147441040)x3 copy number gain See cases [RCV000448731] Chr1:146507518..147441040 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146043713-147897962)x1 copy number loss See cases [RCV000448739] Chr1:146043713..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146101790-147830830)x1 copy number loss See cases [RCV000448963] Chr1:146101790..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146106723-147830830)x3 copy number gain See cases [RCV000448239] Chr1:146106723..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145885646-147844758)x3 copy number gain See cases [RCV000512098] Chr1:145885646..147844758 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146096700-147830830)x3 copy number gain See cases [RCV000512072] Chr1:146096700..147830830 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146096701-147898062)x1 copy number loss See cases [RCV000510373] Chr1:146096701..147898062 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146496382-147409820)x3 copy number gain See cases [RCV000510399] Chr1:146496382..147409820 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-148513854)x1 copy number loss See cases [RCV000510528] Chr1:146105170..148513854 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146347096-147824207)x1 copy number loss not provided [RCV000509202] Chr1:146347096..147824207 [GRCh37]
Chr1:1q21.1-21.2
not provided
GRCh37/hg19 1q21.1-21.2(chr1:146507518-147824207)x1 copy number loss not provided [RCV000509261] Chr1:146507518..147824207 [GRCh37]
Chr1:1q21.1-21.2
not provided
GRCh37/hg19 1p36.33-q44(chr1:849467-249224684)x3 copy number gain See cases [RCV000510383] Chr1:849467..249224684 [GRCh37]
Chr1:1p36.33-q44
pathogenic
NM_181703.4(GJA5):c.586T>G (p.Cys196Gly) single nucleotide variant Hypertrophic cardiomyopathy [RCV000498540] Chr1:147758653 [GRCh38]
Chr1:147230761 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146043713-147929323)x1 copy number loss See cases [RCV000510416] Chr1:146043713..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145808308-147929323)x3 copy number gain See cases [RCV000510318] Chr1:145808308..147929323 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145885646-147947839)x3 copy number gain See cases [RCV000510580] Chr1:145885646..147947839 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146105170-147897962)x1 copy number loss See cases [RCV000511960] Chr1:146105170..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144368497-148636756)x1 copy number loss See cases [RCV000511406] Chr1:144368497..148636756 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146496381-147819294)x3 copy number gain See cases [RCV000511887] Chr1:146496381..147819294 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145895746-148893164)x3 copy number gain See cases [RCV000511678] Chr1:145895746..148893164 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144371838-148832359)x1 copy number loss See cases [RCV000511474] Chr1:144371838..148832359 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146043713-147897962)x1 copy number loss See cases [RCV000511760] Chr1:146043713..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146101790-148020200)x1 copy number loss See cases [RCV000511019] Chr1:146101790..148020200 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144880315-148832359)x1 copy number loss See cases [RCV000511224] Chr1:144880315..148832359 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146498298-147819294)x3 copy number gain See cases [RCV000511122] Chr1:146498298..147819294 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146496425-147814497)x3 copy number gain See cases [RCV000510814] Chr1:146496425..147814497 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145927662-147830830)x4 copy number gain See cases [RCV000511031] Chr1:145927662..147830830 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146003044-147832190)x3 copy number gain See cases [RCV000510735] Chr1:146003044..147832190 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146023923-147929323)x1 copy number loss See cases [RCV000510977] Chr1:146023923..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:143932350-149801420)x3 copy number gain See cases [RCV000511264] Chr1:143932350..149801420 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146470888-147830903)x3 copy number gain See cases [RCV000510918] Chr1:146470888..147830903 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1p36.33-q44(chr1:849467-249224684) copy number gain See cases [RCV000510926] Chr1:849467..249224684 [GRCh37]
Chr1:1p36.33-q44
pathogenic
NM_181703.4(GJA5):c.895G>A (p.Glu299Lys) single nucleotide variant Wolff-Parkinson-White pattern [RCV000656181] Chr1:147758344 [GRCh38]
Chr1:147230452 [GRCh37]
Chr1:1q21.2
uncertain significance
NC_000001.10:g.(?_147230250)_(147231366_?)dup duplication Atrial standstill 1 [RCV000560155] Chr1:147230250..147231366 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146488131-147398560)x3 copy number gain See cases [RCV000512214] Chr1:146488131..147398560 [GRCh37]
Chr1:1q21.1-21.2
pathogenic|uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:145895746-147995251)x3 copy number gain See cases [RCV000512287] Chr1:145895746..147995251 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145808308-147926347)x3 copy number gain See cases [RCV000512412] Chr1:145808308..147926347 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
NM_181703.4(GJA5):c.365C>T (p.Ser122Phe) single nucleotide variant Atrial standstill 1 [RCV000649050] Chr1:147758874 [GRCh38]
Chr1:147230982 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146105170-148020200)x1 copy number loss See cases [RCV000512350] Chr1:146105170..148020200 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.430G>A (p.Ala144Thr) single nucleotide variant Atrial standstill 1 [RCV000687042] Chr1:147758809 [GRCh38]
Chr1:147230917 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:144549794-147978640)x3 copy number gain not provided [RCV000684622] Chr1:144549794..147978640 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144842544-148832359)x1 copy number loss not provided [RCV000684624] Chr1:144842544..148832359 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144884331-148514236)x1 copy number loss not provided [RCV000684625] Chr1:144884331..148514236 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145068491-147929323)x1 copy number loss not provided [RCV000684626] Chr1:145068491..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145376052-147819815)x3 copy number gain not provided [RCV000684628] Chr1:145376052..147819815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145733443-147929323)x1 copy number loss not provided [RCV000684633] Chr1:145733443..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145764393-147830830)x1 copy number loss not provided [RCV000684634] Chr1:145764393..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145769108-147929323)x1 copy number loss not provided [RCV000684635] Chr1:145769108..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145770625-148514899)x1 copy number loss not provided [RCV000684636] Chr1:145770625..148514899 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145770679-147926347)x1 copy number loss not provided [RCV000684637] Chr1:145770679..147926347 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145770679-148519140)x1 copy number loss not provided [RCV000684638] Chr1:145770679..148519140 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145784611-148519963)x1 copy number loss not provided [RCV000684639] Chr1:145784611..148519963 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145786289-147830830)x1 copy number loss not provided [RCV000684640] Chr1:145786289..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145786360-148514899)x1 copy number loss not provided [RCV000684641] Chr1:145786360..148514899 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145792037-147929323)x1 copy number loss not provided [RCV000684642] Chr1:145792037..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145792051-148846369)x1 copy number loss not provided [RCV000684643] Chr1:145792051..148846369 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145895746-147897962)x1 copy number loss not provided [RCV000684644] Chr1:145895746..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145895746-147926347)x1 copy number loss not provided [RCV000684645] Chr1:145895746..147926347 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146030328-147897962)x1 copy number loss not provided [RCV000684646] Chr1:146030328..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146043713-147898062)x1 copy number loss not provided [RCV000684647] Chr1:146043713..147898062 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146117290-147897962)x1 copy number loss not provided [RCV000684648] Chr1:146117290..147897962 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146145424-147830830)x1 copy number loss not provided [RCV000684649] Chr1:146145424..147830830 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146470887-147845170)x1 copy number loss not provided [RCV000684650] Chr1:146470887..147845170 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146470887-148020200)x1 copy number loss not provided [RCV000684651] Chr1:146470887..148020200 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146483912-147828510)x1 copy number loss not provided [RCV000684652] Chr1:146483912..147828510 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146505911-147829213)x1 copy number loss not provided [RCV000684653] Chr1:146505911..147829213 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.973A>C (p.Asn325His) single nucleotide variant Atrial standstill 1 [RCV000700470] Chr1:147758266 [GRCh38]
Chr1:147230374 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.325C>T (p.Arg109Trp) single nucleotide variant Atrial standstill 1 [RCV000697922] Chr1:147758914 [GRCh38]
Chr1:147231022 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.433del (p.Leu145fs) deletion Atrial standstill 1 [RCV000688023] Chr1:147758806 [GRCh38]
Chr1:147230914 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.259A>T (p.Thr87Ser) single nucleotide variant Atrial standstill 1 [RCV000691421] Chr1:147758980 [GRCh38]
Chr1:147231088 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.977G>A (p.Gly326Glu) single nucleotide variant Atrial standstill 1 [RCV000686037] Chr1:147758262 [GRCh38]
Chr1:147230370 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.496G>A (p.Gly166Ser) single nucleotide variant Atrial standstill 1 [RCV000700700] Chr1:147758743 [GRCh38]
Chr1:147230851 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1p36.33-q44(chr1:47851-249228449)x3 copy number gain not provided [RCV000736295] Chr1:47851..249228449 [GRCh37]
Chr1:1p36.33-q44
pathogenic
GRCh37/hg19 1p36.33-q44(chr1:82154-249218992)x3 copy number gain not provided [RCV000736305] Chr1:82154..249218992 [GRCh37]
Chr1:1p36.33-q44
pathogenic
NC_000001.11:g.(?_145430995)_(148257619_?)del deletion Schizophrenia [RCV000754126] Chr1:145430995..148257619 [GRCh38]
Chr1:1q21.1-21.2
pathogenic
NC_000001.11:g.(?_145430995)_(148427734_?)del deletion Schizophrenia [RCV000754127] Chr1:145430995..148427734 [GRCh38]
Chr1:1q21.1-21.2
pathogenic
NC_000001.11:g.(?_145580669)_(149095000_?)del deletion Schizophrenia [RCV000754128] Chr1:145580669..149095000 [GRCh38]
Chr1:1q21.1-21.2
pathogenic
Single allele duplication Schizophrenia [RCV000754132] Chr1:145601945..148889374 [GRCh38]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146087074-148209414)x3 copy number gain not provided [RCV000736678] Chr1:146087074..148209414 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146087074-148250606)x3 copy number gain not provided [RCV000736679] Chr1:146087074..148250606 [GRCh37]
Chr1:1q21.1-21.2
benign
GRCh37/hg19 1q21.1-21.2(chr1:146089254-147391614)x1 copy number loss not provided [RCV000736680] Chr1:146089254..147391614 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146089254-147911246)x1 copy number loss not provided [RCV000736681] Chr1:146089254..147911246 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146089268-147826789)x3 copy number gain not provided [RCV000736682] Chr1:146089268..147826789 [GRCh37]
Chr1:1q21.1-21.2
benign
GRCh37/hg19 1q21.1-21.2(chr1:146089268-147826789)x1 copy number loss not provided [RCV000736683] Chr1:146089268..147826789 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146089268-149376652)x1 copy number loss not provided [RCV000736684] Chr1:146089268..149376652 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146501348-147393410)x1 copy number loss not provided [RCV000736685] Chr1:146501348..147393410 [GRCh37]
Chr1:1q21.1-21.2
benign
GRCh37/hg19 1q21.1-21.2(chr1:146501348-147826789)x3 copy number gain not provided [RCV000736686] Chr1:146501348..147826789 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146506206-147928995)x3 copy number gain not provided [RCV000749173] Chr1:146506206..147928995 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.2(chr1:147191841-147310152)x3 copy number gain not provided [RCV000749176] Chr1:147191841..147310152 [GRCh37]
Chr1:1q21.2
benign
GRCh37/hg19 1q21.2(chr1:147191841-147357928)x3 copy number gain not provided [RCV000749177] Chr1:147191841..147357928 [GRCh37]
Chr1:1q21.2
benign
GRCh37/hg19 1q21.1-21.2(chr1:145395440-148242053)x3 copy number gain not provided [RCV000749164] Chr1:145395440..148242053 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146501348-147843733)x1 copy number loss not provided [RCV000749171] Chr1:146501348..147843733 [GRCh37]
Chr1:1q21.1-21.2
likely pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146506206-147531377)x3 copy number gain not provided [RCV000749172] Chr1:146506206..147531377 [GRCh37]
Chr1:1q21.1-21.2
benign
GRCh37/hg19 1q21.1-21.2(chr1:145015937-147416122) copy number gain Chromosome 1q21.1 duplication syndrome [RCV000767544] Chr1:145015937..147416122 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.2(chr1:147245049-147246661) copy number loss Atrial fibrillation, familial, 11 [RCV000767777] Chr1:147245049..147246661 [GRCh37]
Chr1:1q21.2
pathogenic
NM_181703.4(GJA5):c.744C>A (p.Cys248Ter) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000778936] Chr1:147758495 [GRCh38]
Chr1:147230603 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.241C>T (p.Gln81Ter) single nucleotide variant Atrial fibrillation, familial, 11 [RCV000778937] Chr1:147758998 [GRCh38]
Chr1:147231106 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.726G>A (p.Arg242=) single nucleotide variant Atrial standstill 1 [RCV000863025]|not provided [RCV001565775] Chr1:147758513 [GRCh38]
Chr1:147230621 [GRCh37]
Chr1:1q21.2
benign|likely benign
GRCh37/hg19 1q21.1-21.2(chr1:146521698-147721869)x1 copy number loss 1q21.1 recurrent microdeletion [RCV000856631] Chr1:146521698..147721869 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145804679-147735815)x3 copy number gain Chromosome 1q21.1 duplication syndrome [RCV000856632] Chr1:145804679..147735815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NC_000001.10:g.(?_147230260)_(147245383_?)del deletion Atrial standstill 1 [RCV000816622] Chr1:147230260..147245383 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.148G>A (p.Ala50Thr) single nucleotide variant Atrial standstill 1 [RCV000791685] Chr1:147759091 [GRCh38]
Chr1:147231199 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.411G>T (p.Glu137Asp) single nucleotide variant Atrial standstill 1 [RCV000799878] Chr1:147758828 [GRCh38]
Chr1:147230936 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:144823069-148839976)x3 copy number gain not provided [RCV000848311] Chr1:144823069..148839976 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
Single allele duplication Neurodevelopmental disorder [RCV000787409] Chr1:146474245..147858400 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
NM_181703.4(GJA5):c.199G>T (p.Asp67Tyr) single nucleotide variant Atrial standstill 1 [RCV000822679] Chr1:147759040 [GRCh38]
Chr1:147231148 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.793C>T (p.Pro265Ser) single nucleotide variant Atrial standstill 1 [RCV000803226]|not provided [RCV001700307] Chr1:147758446 [GRCh38]
Chr1:147230554 [GRCh37]
Chr1:1q21.2
uncertain significance
Single allele deletion 1q21.1 recurrent microdeletion [RCV000844901] Chr1:145723417..147897962 [GRCh37]
Chr1:1q21.1-21.2
not provided
GRCh37/hg19 1q21.1-21.2(chr1:144842544-147832190)x1 copy number loss not provided [RCV001005133] Chr1:144842544..147832190 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:143940435-147845170)x4 copy number gain not provided [RCV000849214] Chr1:143940435..147845170 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.513G>A (p.Gln171=) single nucleotide variant Atrial standstill 1 [RCV001428299]|not provided [RCV000936262] Chr1:147758726 [GRCh38]
Chr1:147230834 [GRCh37]
Chr1:1q21.2
likely benign
GRCh37/hg19 1q21.2(chr1:147201195-147309340)x3 copy number gain not provided [RCV000848458] Chr1:147201195..147309340 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.2(chr1:147201195-147309340)x3 copy number gain not provided [RCV000848459] Chr1:147201195..147309340 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.2(chr1:147185887-147309340)x3 copy number gain not provided [RCV000849553] Chr1:147185887..147309340 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:143940435-147823872)x3 copy number gain not provided [RCV001005132] Chr1:143940435..147823872 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.297T>G (p.Thr99=) single nucleotide variant Atrial standstill 1 [RCV001205815] Chr1:147758942 [GRCh38]
Chr1:147231050 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.790C>A (p.Pro264Thr) single nucleotide variant Atrial standstill 1 [RCV001247018] Chr1:147758449 [GRCh38]
Chr1:147230557 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*53= variation not provided [RCV001534906] Chr1:147758109 [GRCh38]
Chr1:147230217 [GRCh37]
Chr1:1q21.2
benign
NM_004837.4(GGPS1):c.782G>A (p.Arg261His) AND MUSCULAR DYSTROPHY, CONGENITAL HEARING LOSS, single nucleotide variant not provided [RCV001639385] Chr1:147759423 [GRCh38]
Chr1:147231531 [GRCh37]
Chr1:1q21.2
benign
null single nucleotide variant not provided [RCV001710094] Chr1:147759579 [GRCh38]
Chr1:147231687 [GRCh37]
Chr1:1q21.2
benign
NM_181703.4(GJA5):c.358T>C (p.Ser120Pro) single nucleotide variant Atrial standstill 1 [RCV001237185] Chr1:147758881 [GRCh38]
Chr1:147230989 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.592G>A (p.Val198Ile) single nucleotide variant Atrial standstill 1 [RCV001066085] Chr1:147758647 [GRCh38]
Chr1:147230755 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.1057T>G (p.Ser353Ala) single nucleotide variant Atrial fibrillation, familial, 11 [RCV001100362] Chr1:147758182 [GRCh38]
Chr1:147230290 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:145053968-148823133)x3 copy number gain not provided [RCV001005135] Chr1:145053968..148823133 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144884331-148665189)x1 copy number loss not provided [RCV001005134] Chr1:144884331..148665189 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.*498A>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV001098592] Chr1:147757664 [GRCh38]
Chr1:147229772 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.*22G>A single nucleotide variant Atrial fibrillation, familial, 11 [RCV001100361] Chr1:147758140 [GRCh38]
Chr1:147230248 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.956A>T (p.Gln319Leu) single nucleotide variant Atrial fibrillation, familial, 11 [RCV001102337] Chr1:147758283 [GRCh38]
Chr1:147230391 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.377C>T (p.Pro126Leu) single nucleotide variant Atrial fibrillation, familial, 11 [RCV001102339] Chr1:147758862 [GRCh38]
Chr1:147230970 [GRCh37]
Chr1:1q21.2
uncertain significance
NC_000001.10:g.(?_147230260)_(147245383_?)dup duplication Atrial standstill 1 [RCV001032308] Chr1:147230260..147245383 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.479G>T (p.Arg160Leu) single nucleotide variant Atrial standstill 1 [RCV001047602] Chr1:147758760 [GRCh38]
Chr1:147230868 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146501348-147825548)x3 copy number gain See cases [RCV001007413] Chr1:146501348..147825548 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.*333C>G single nucleotide variant Atrial fibrillation, familial, 11 [RCV001098593] Chr1:147757829 [GRCh38]
Chr1:147229937 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_005266.7(GJA5):c.-125C>T single nucleotide variant Atrial fibrillation, familial, 11 [RCV001098685] Chr1:147773343 [GRCh38]
Chr1:147245447 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.478C>T (p.Arg160Cys) single nucleotide variant Atrial standstill 1 [RCV001245886] Chr1:147758761 [GRCh38]
Chr1:147230869 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.1006G>A (p.Gly336Ser) single nucleotide variant Atrial standstill 1 [RCV001040652] Chr1:147758233 [GRCh38]
Chr1:147230341 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.947G>A (p.Arg316His) single nucleotide variant Atrial standstill 1 [RCV001036824] Chr1:147758292 [GRCh38]
Chr1:147230400 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.938T>C (p.Ile313Thr) single nucleotide variant Atrial fibrillation, familial, 11 [RCV001102338] Chr1:147758301 [GRCh38]
Chr1:147230409 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.1035_1038del (p.Ser345fs) deletion Atrial standstill 1 [RCV001038159] Chr1:147758201..147758204 [GRCh38]
Chr1:147230309..147230312 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.348G>A (p.Glu116=) single nucleotide variant Atrial fibrillation, familial, 11 [RCV001102340]|Atrial standstill 1 [RCV001416959] Chr1:147758891 [GRCh38]
Chr1:147230999 [GRCh37]
Chr1:1q21.2
likely benign|uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146500000-149500001)x3 copy number gain See cases [RCV001264401] Chr1:146500000..149500001 [GRCh37]
Chr1:1q21.1-21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:146112080-147819815)x3 copy number gain not provided [RCV001260120] Chr1:146112080..147819815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146112080-147399145)x3 copy number gain not provided [RCV001260121] Chr1:146112080..147399145 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NC_000001.10:g.(?_130980840)_(248900000_?)dup duplication Gastrointestinal stromal tumor [RCV001300221]|Parathyroid carcinoma [RCV001341077] Chr1:130980840..248900000 [GRCh37]
Chr1:1q12-44
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:144887445-148801960)x1 copy number loss not provided [RCV001260118] Chr1:144887445..148801960 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146498298-147401392)x3 copy number gain not provided [RCV001260119] Chr1:146498298..147401392 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146496425-147819815)x3 copy number gain not provided [RCV001260122] Chr1:146496425..147819815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146096700-147929323)x1 copy number loss not provided [RCV001260123] Chr1:146096700..147929323 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:144849457-147819815)x3 copy number gain not provided [RCV001260124] Chr1:144849457..147819815 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.2(chr1:147186575-147314482)x3 copy number gain not provided [RCV001260125] Chr1:147186575..147314482 [GRCh37]
Chr1:1q21.2
uncertain significance
NC_000001.10:g.(?_147230260)_(147245383_?)dup duplication Atrial standstill 1 [RCV001304853] Chr1:147230260..147245383 [GRCh37]
Chr1:1q21.2
uncertain significance
GRCh37/hg19 1q21.1-21.2(chr1:145818702-147824207) copy number gain Mayer-Rokitansky-Kuster-Hauser syndrome [RCV001291962] Chr1:145818702..147824207 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:146506310-147824207) copy number loss Delayed speech and language development [RCV001291984] Chr1:146506310..147824207 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
GRCh37/hg19 1q21.1-21.2(chr1:145818702-149378266) copy number gain Delayed speech and language development [RCV001291985] Chr1:145818702..149378266 [GRCh37]
Chr1:1q21.1-21.2
pathogenic
NM_181703.4(GJA5):c.771dup (p.Val258fs) duplication Atrial standstill 1 [RCV001325739] Chr1:147758467..147758468 [GRCh38]
Chr1:147230575..147230576 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.787C>T (p.Pro263Ser) single nucleotide variant Atrial standstill 1 [RCV001321184] Chr1:147758452 [GRCh38]
Chr1:147230560 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.199G>A (p.Asp67Asn) single nucleotide variant Atrial standstill 1 [RCV001317751] Chr1:147759040 [GRCh38]
Chr1:147231148 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.525C>G (p.Tyr175Ter) single nucleotide variant Atrial standstill 1 [RCV001337728] Chr1:147758714 [GRCh38]
Chr1:147230822 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.544C>T (p.Leu182=) single nucleotide variant Atrial standstill 1 [RCV001397695] Chr1:147758695 [GRCh38]
Chr1:147230803 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.864C>T (p.Ala288=) single nucleotide variant Atrial standstill 1 [RCV001433099] Chr1:147758375 [GRCh38]
Chr1:147230483 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.278T>C (p.Met93Thr) single nucleotide variant Atrial standstill 1 [RCV001342377] Chr1:147758961 [GRCh38]
Chr1:147231069 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.170T>G (p.Ile57Ser) single nucleotide variant Atrial standstill 1 [RCV001372445] Chr1:147759069 [GRCh38]
Chr1:147231177 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.941A>G (p.Gln314Arg) single nucleotide variant Atrial standstill 1 [RCV001298291] Chr1:147758298 [GRCh38]
Chr1:147230406 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.1024C>T (p.Arg342Ter) single nucleotide variant Atrial standstill 1 [RCV001365526] Chr1:147758215 [GRCh38]
Chr1:147230323 [GRCh37]
Chr1:1q21.2
uncertain significance
NM_181703.4(GJA5):c.147G>A (p.Gln49=) single nucleotide variant Atrial standstill 1 [RCV001484622] Chr1:147759092 [GRCh38]
Chr1:147231200 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.327G>A (p.Arg109=) single nucleotide variant Atrial standstill 1 [RCV001403128] Chr1:147758912 [GRCh38]
Chr1:147231020 [GRCh37]
Chr1:1q21.2
likely benign
NM_005266.7(GJA5):c.-33-1361= variation Atrial standstill 1 [RCV001516274] Chr1:147760632 [GRCh38]
Chr1:147232740 [GRCh37]
Chr1:1q21.2
benign
NM_181703.4(GJA5):c.472C>T (p.Leu158=) single nucleotide variant Atrial standstill 1 [RCV001516081] Chr1:147758767 [GRCh38]
Chr1:147230875 [GRCh37]
Chr1:1q21.2
benign
NM_181703.4(GJA5):c.117A>G (p.Thr39=) single nucleotide variant Atrial standstill 1 [RCV001459945] Chr1:147759122 [GRCh38]
Chr1:147231230 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.111G>A (p.Leu37=) single nucleotide variant Atrial standstill 1 [RCV001488394] Chr1:147759128 [GRCh38]
Chr1:147231236 [GRCh37]
Chr1:1q21.2
likely benign
NM_181703.4(GJA5):c.903A>G (p.Val301=) single nucleotide variant Atrial standstill 1 [RCV001400272] Chr1:147758336 [GRCh38]
Chr1:147230444 [GRCh37]
Chr1:1q21.2
likely benign

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:4279 AgrOrtholog
COSMIC GJA5 COSMIC
Ensembl Genes ENSG00000265107 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Ensembl Protein ENSP00000407645 UniProtKB/TrEMBL
  ENSP00000463851 ENTREZGENE, UniProtKB/Swiss-Prot
  ENSP00000484552 ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000430508 UniProtKB/TrEMBL
  ENST00000579774 ENTREZGENE, UniProtKB/Swiss-Prot
  ENST00000621517 ENTREZGENE, UniProtKB/Swiss-Prot
Gene3D-CATH 1.20.1440.80 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
GTEx ENSG00000265107 GTEx
HGNC ID HGNC:4279 ENTREZGENE
Human Proteome Map GJA5 Human Proteome Map
InterPro Connexin UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin40 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_C UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_CCC UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_CS UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_N UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_N_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Cx40_C UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report hsa:2702 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
NCBI Gene 2702 ENTREZGENE
OMIM 108770 OMIM
  121013 OMIM
  614049 OMIM
PANTHER PTHR11984 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  PTHR11984:SF13 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Pfam Connexin UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin40_C UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB GJA5 RGD, PharmGKB
PRINTS CONNEXIN UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  CONNEXINA5 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PROSITE CONNEXINS_1 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  CONNEXINS_2 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
SMART CNX UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Connexin_CCC UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Superfamily-SCOP SSF118220 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt A0A0B4J1Y3_HUMAN UniProtKB/TrEMBL
  CXA5_HUMAN UniProtKB/Swiss-Prot, ENTREZGENE
  X5D2H9 ENTREZGENE, UniProtKB/TrEMBL
UniProt Secondary A0A024QZ37 UniProtKB/TrEMBL
  Q5T3B6 UniProtKB/Swiss-Prot
  Q5U0N6 UniProtKB/Swiss-Prot


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2015-11-17 GJA5  gap junction protein alpha 5    gap junction protein, alpha 5, 40kDa  Symbol and/or name change 5135510 APPROVED
2011-08-16 GJA5  gap junction protein, alpha 5, 40kDa  GJA5  gap junction protein, alpha 5, 40kDa  Symbol and/or name change 5135510 APPROVED