MAOA (monoamine oxidase A) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: MAOA (monoamine oxidase A) Homo sapiens
Analyze
Symbol: MAOA
Name: monoamine oxidase A
RGD ID: 735751
HGNC Page HGNC
Description: Predicted to have primary amine oxidase activity. Predicted to be involved in cytokine-mediated signaling pathway; dopamine catabolic process; and neurotransmitter metabolic process. Localizes to cytosol and mitochondrion. Implicated in Alzheimer's disease; Brunner Syndrome; alcohol use disorder; autism spectrum disorder; and panic disorder.
Type: protein-coding
RefSeq Status: REVIEWED
Also known as: amine oxidase [flavin-containing] A; BRNRS; MAO-A; monoamine oxidase type A
RGD Orthologs
Mouse
Rat
Chinchilla
Bonobo
Dog
Squirrel
Pig
Green Monkey
Naked Mole-Rat
Alliance Genes
More Info more info ...
Allele / Splice: See ClinVar data
Latest Assembly: GRCh38 - Human Genome Assembly GRCh38
Position:
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX43,654,907 - 43,746,824 (+)EnsemblGRCh38hg38GRCh38
GRCh38X43,655,006 - 43,746,817 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X43,514,254 - 43,606,064 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36X43,400,353 - 43,491,012 (+)NCBINCBI36hg18NCBI36
Build 34X43,271,662 - 43,362,321NCBI
CeleraX47,658,765 - 47,745,839 (+)NCBI
Cytogenetic MapXp11.3NCBI
HuRefX41,244,782 - 41,335,636 (+)NCBIHuRef
CHM1_1X43,547,315 - 43,639,233 (+)NCBICHM1_1
JBrowse: View Region in Genome Browser (JBrowse)
Model


Gene-Chemical Interaction Annotations     Click to see Annotation Detail View
(-)-selegiline  (EXP)
(5-hydroxyindol-3-yl)acetaldehyde  (ISO)
(5-hydroxyindol-3-yl)acetic acid  (ISO)
(R)-noradrenaline  (EXP,ISO)
(S)-nicotine  (ISO)
1,1-dichloroethene  (ISO)
1,2-dichloroethane  (ISO)
1,2-dimethylhydrazine  (ISO)
1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine  (ISO)
17beta-estradiol  (EXP,ISO)
17beta-hydroxy-17-methylestra-4,9,11-trien-3-one  (EXP)
2,3,7,8-tetrachlorodibenzodioxine  (EXP,ISO)
2,4,6-trinitrobenzenesulfonic acid  (ISO)
2-methoxyethanol  (ISO)
2-methylcholine  (EXP)
3,3',4,4',5-pentachlorobiphenyl  (ISO)
3,4-Methylenedioxyamphetamine  (EXP)
3,4-methylenedioxymethamphetamine  (EXP)
3-Amino-1-methyl-5H-pyrido[4,3-b]indole  (EXP)
4,4'-sulfonyldiphenol  (EXP)
5-aza-2'-deoxycytidine  (EXP)
5-methyl-N'-(phenylmethyl)-3-isoxazolecarbohydrazide  (EXP)
6-propyl-2-thiouracil  (ISO)
aflatoxin B1  (EXP)
all-trans-retinoic acid  (EXP)
almotriptan  (EXP)
alpha-methyltryptamine  (EXP)
alpha-Zearalanol  (EXP)
amitraz  (ISO)
amitriptyline  (ISO)
ammonium acetate  (ISO)
ammonium chloride  (ISO)
amphetamine  (ISO)
arecoline  (EXP)
arsane  (EXP,ISO)
arsenic atom  (EXP,ISO)
arsenous acid  (EXP)
astemizole  (ISO)
atrazine  (EXP,ISO)
benzo[a]pyrene  (EXP,ISO)
benzo[b]fluoranthene  (ISO)
benzyl benzoate  (EXP)
benzyl cinnamate  (EXP)
beta-carboline  (EXP)
beta-naphthoflavone  (EXP)
bis(2-ethylhexyl) phthalate  (ISO)
bisphenol A  (EXP,ISO)
bisphenol F  (ISO)
cadmium atom  (ISO)
caffeine  (ISO)
calcitriol  (EXP)
captan  (ISO)
carbamazepine  (EXP)
carbon nanotube  (ISO)
chlorogenic acid  (EXP)
chloropicrin  (EXP)
chlorpyrifos  (ISO)
choline  (ISO)
chrysene  (ISO)
cis-caffeic acid  (EXP)
cisplatin  (EXP,ISO)
clorgyline  (EXP,ISO)
cobalt dichloride  (ISO)
cocaine  (ISO)
copper atom  (EXP,ISO)
copper(0)  (EXP,ISO)
copper(II) sulfate  (EXP)
cortisol  (EXP)
curcumin  (ISO)
cyclophosphamide  (EXP)
cyclosporin A  (EXP)
cypermethrin  (ISO)
dexamethasone  (EXP,ISO)
dextran sulfate  (ISO)
diarsenic trioxide  (EXP)
dibutyl phthalate  (ISO)
dichlorvos  (ISO)
diclofenac  (EXP)
diethyl maleate  (ISO)
diethylstilbestrol  (EXP,ISO)
dioxygen  (EXP)
disulfiram  (EXP)
diuron  (ISO)
dopamine  (EXP,ISO)
dorsomorphin  (EXP)
doxorubicin  (EXP,ISO)
endosulfan  (EXP)
entinostat  (EXP)
ethanol  (EXP,ISO)
fenvalerate  (ISO)
finasteride  (ISO)
flavanone  (EXP)
flavone  (EXP)
flutamide  (ISO)
folic acid  (ISO)
folpet  (ISO)
fructose  (ISO)
fucoxanthin  (EXP)
genistein  (EXP,ISO)
harmaline  (EXP,ISO)
harman  (EXP)
harmine  (EXP,ISO)
Heliotrine  (EXP)
hydralazine  (EXP)
indol-3-ylacetaldehyde  (EXP)
iron atom  (ISO)
iron(0)  (ISO)
isoflavones  (EXP)
kojic acid  (ISO)
kynuramine  (EXP)
L-methionine  (ISO)
lead(0)  (ISO)
lead(2+)  (ISO)
lead(II) chloride  (ISO)
luteolin  (EXP,ISO)
Metanephrine  (EXP)
methamphetamine  (ISO)
methapyrilene  (ISO)
methotrexate  (EXP)
mifepristone  (EXP)
mithramycin  (EXP)
moclobemide  (EXP,ISO)
monocrotophos  (ISO)
monosodium L-glutamate  (ISO)
N(gamma)-nitro-L-arginine methyl ester  (ISO)
N-methyl-4-phenylpyridinium  (EXP)
N-nitrosodiethylamine  (ISO)
naringin  (ISO)
nefazodone  (ISO)
nickel atom  (EXP)
nickel sulfate  (EXP)
nicotine  (ISO)
nitroprusside  (ISO)
ochratoxin A  (ISO)
olanzapine  (ISO)
Paeonol  (ISO)
paracetamol  (EXP,ISO)
parathion-methyl  (ISO)
Pargyline  (ISO)
perfluorooctanoic acid  (EXP,ISO)
phenobarbital  (ISO)
phenylephrine  (ISO)
phenylmercury acetate  (EXP)
phenylpropanolamine  (EXP,ISO)
phosphamidon  (ISO)
piperine  (ISO)
pirinixic acid  (ISO)
procarbazine  (ISO)
progesterone  (EXP)
propanal  (EXP)
quercetin  (EXP,ISO)
resveratrol  (ISO)
risperidone  (EXP)
rosmarinic acid  (EXP)
rotenone  (ISO)
SB 431542  (EXP)
senecionine  (EXP)
Senkirkine  (EXP)
serotonin  (EXP,ISO)
sertraline  (EXP)
simazine  (ISO)
sodium arsenite  (EXP,ISO)
sodium fluoride  (ISO)
sulindac  (ISO)
tamoxifen  (ISO)
testosterone  (ISO)
tetrachloromethane  (ISO)
tetraphene  (ISO)
thapsigargin  (EXP)
thimerosal  (EXP)
titanium dioxide  (ISO)
toloxatone  (ISO)
toluene  (ISO)
trans-caffeic acid  (EXP)
trichostatin A  (EXP)
troglitazone  (EXP)
tryptamine  (EXP)
tyramine  (EXP)
valproic acid  (EXP)
vorinostat  (EXP)
yohimbine  (EXP)

Gene Ontology Annotations     Click to see Annotation Detail View

Cellular Component

Molecular Function

Phenotype Annotations     Click to see Annotation Detail View
References

Additional References at PubMed
PMID:1432104   PMID:1546132   PMID:1578281   PMID:1783405   PMID:1886775   PMID:2021654   PMID:2023912   PMID:2414414   PMID:2483108   PMID:2744764   PMID:2764901   PMID:2793188  
PMID:2906043   PMID:3178846   PMID:3387449   PMID:3418353   PMID:3540317   PMID:6408492   PMID:6788990   PMID:7063850   PMID:7519662   PMID:8125298   PMID:8211186   PMID:8316221  
PMID:8503438   PMID:8584674   PMID:8678123   PMID:8889548   PMID:10647887   PMID:11121185   PMID:11140838   PMID:11304831   PMID:11353450   PMID:11443519   PMID:11761322   PMID:11805333  
PMID:11812236   PMID:11861643   PMID:11920860   PMID:11927135   PMID:11945082   PMID:11963571   PMID:11992558   PMID:11992559   PMID:11992560   PMID:11999895   PMID:12098640   PMID:12116182  
PMID:12136060   PMID:12140786   PMID:12151768   PMID:12161658   PMID:12163988   PMID:12164325   PMID:12170473   PMID:12360111   PMID:12399942   PMID:12428723   PMID:12445480   PMID:12477932  
PMID:12497608   PMID:12497620   PMID:12502014   PMID:12554604   PMID:12555227   PMID:12555234   PMID:12563176   PMID:12566936   PMID:12607224   PMID:12629534   PMID:12648733   PMID:12650952  
PMID:12668354   PMID:12773616   PMID:12777388   PMID:12778446   PMID:12815746   PMID:12824808   PMID:12877392   PMID:12886034   PMID:12919132   PMID:14520117   PMID:14697881   PMID:14962671  
PMID:15024395   PMID:15034227   PMID:15052272   PMID:15088154   PMID:15094788   PMID:15150530   PMID:15211623   PMID:15241435   PMID:15261699   PMID:15292674   PMID:15341275   PMID:15346539  
PMID:15349769   PMID:15450911   PMID:15457497   PMID:15486489   PMID:15489334   PMID:15498245   PMID:15523490   PMID:15539858   PMID:15556933   PMID:15564894   PMID:15635592   PMID:15694196  
PMID:15722955   PMID:15806601   PMID:15870836   PMID:15936529   PMID:15956990   PMID:15990460   PMID:16094253   PMID:16110245   PMID:16125147   PMID:16129825   PMID:16139427   PMID:16174289  
PMID:16186632   PMID:16202396   PMID:16207390   PMID:16272956   PMID:16319504   PMID:16360899   PMID:16526025   PMID:16538181   PMID:16538182   PMID:16547693   PMID:16584839   PMID:16610949  
PMID:16674552   PMID:16725119   PMID:16728402   PMID:16741202   PMID:16763378   PMID:16770335   PMID:16801953   PMID:16806099   PMID:16814261   PMID:16829576   PMID:16848906   PMID:16856146  
PMID:16890910   PMID:16893905   PMID:16894395   PMID:16896926   PMID:16930369   PMID:16944667   PMID:16958037   PMID:17007976   PMID:17008143   PMID:17020906   PMID:17026953   PMID:17034017  
PMID:17044053   PMID:17141746   PMID:17167335   PMID:17192957   PMID:17208375   PMID:17217235   PMID:17220478   PMID:17221847   PMID:17230031   PMID:17295220   PMID:17298646   PMID:17328795  
PMID:17340199   PMID:17393061   PMID:17400359   PMID:17417058   PMID:17426915   PMID:17427196   PMID:17429405   PMID:17440951   PMID:17449559   PMID:17453062   PMID:17476365   PMID:17519928  
PMID:17534436   PMID:17563839   PMID:17585061   PMID:17592478   PMID:17627031   PMID:17657171   PMID:17680543   PMID:17692293   PMID:17728669   PMID:17868476   PMID:17883400   PMID:17884271  
PMID:17885625   PMID:17885758   PMID:17894408   PMID:17920180   PMID:17931441   PMID:17943028   PMID:17944104   PMID:18023041   PMID:18029114   PMID:18046978   PMID:18046979   PMID:18075472  
PMID:18079067   PMID:18092818   PMID:18188752   PMID:18212819   PMID:18227761   PMID:18239643   PMID:18248494   PMID:18258310   PMID:18261931   PMID:18270970   PMID:18294618   PMID:18337637  
PMID:18361446   PMID:18387780   PMID:18388730   PMID:18391214   PMID:18405062   PMID:18405071   PMID:18430257   PMID:18437281   PMID:18454435   PMID:18463263   PMID:18474080   PMID:18486967  
PMID:18501009   PMID:18504633   PMID:18544183   PMID:18566880   PMID:18596609   PMID:18607773   PMID:18626920   PMID:18639608   PMID:18676680   PMID:18726986   PMID:18752729   PMID:18810510  
PMID:18827956   PMID:18832011   PMID:18845200   PMID:18937309   PMID:18955512   PMID:18971477   PMID:19005081   PMID:19032968   PMID:19058789   PMID:19064571   PMID:19077664   PMID:19086053  
PMID:19100789   PMID:19120058   PMID:19156168   PMID:19168625   PMID:19170196   PMID:19194374   PMID:19214141   PMID:19223155   PMID:19224413   PMID:19247474   PMID:19248248   PMID:19255579  
PMID:19267171   PMID:19302089   PMID:19309535   PMID:19333405   PMID:19337825   PMID:19357553   PMID:19368859   PMID:19382113   PMID:19398936   PMID:19415821   PMID:19455600   PMID:19485616  
PMID:19492728   PMID:19506579   PMID:19506906   PMID:19539632   PMID:19548263   PMID:19573521   PMID:19583892   PMID:19593178   PMID:19625011   PMID:19642709   PMID:19645722   PMID:19657584  
PMID:19666839   PMID:19692168   PMID:19693267   PMID:19727210   PMID:19777560   PMID:19796878   PMID:19818126   PMID:19829167   PMID:19859025   PMID:19874574   PMID:19892410   PMID:19913121  
PMID:19915868   PMID:19935847   PMID:19941049   PMID:19951362   PMID:20010318   PMID:20033274   PMID:20041956   PMID:20046877   PMID:20078943   PMID:20127808   PMID:20152292   PMID:20175604  
PMID:20187845   PMID:20201935   PMID:20204405   PMID:20206656   PMID:20213484   PMID:20218801   PMID:20303364   PMID:20332182   PMID:20351714   PMID:20354746   PMID:20364435   PMID:20374544  
PMID:20421737   PMID:20435093   PMID:20461808   PMID:20464528   PMID:20468064   PMID:20477771   PMID:20485326   PMID:20497231   PMID:20573161   PMID:20589923   PMID:20595415   PMID:20628086  
PMID:20652353   PMID:20677440   PMID:20691428   PMID:20729761   PMID:20731636   PMID:20734064   PMID:20734127   PMID:20820831   PMID:20833797   PMID:20850185   PMID:20862259   PMID:20869421  
PMID:20873971   PMID:20967566   PMID:21039487   PMID:21075085   PMID:21099450   PMID:21114364   PMID:21147794   PMID:21152968   PMID:21177257   PMID:21236646   PMID:21273708   PMID:21295226  
PMID:21299892   PMID:21302344   PMID:21359973   PMID:21383264   PMID:21422455   PMID:21516943   PMID:21521428   PMID:21530215   PMID:21538940   PMID:21605465   PMID:21610556   PMID:21698196  
PMID:21761555   PMID:21775495   PMID:21819071   PMID:21884321   PMID:21912191   PMID:21912392   PMID:21934643   PMID:21971000   PMID:21971001   PMID:21971004   PMID:21978760   PMID:21983350  
PMID:22030358   PMID:22041522   PMID:22162429   PMID:22193458   PMID:22198720   PMID:22336227   PMID:22351881   PMID:22436428   PMID:22473857   PMID:22569243   PMID:22619623   PMID:22627167  
PMID:22711722   PMID:22781862   PMID:22832821   PMID:22906985   PMID:22911667   PMID:22948232   PMID:22985017   PMID:23044341   PMID:23054588   PMID:23067570   PMID:23076524   PMID:23088179  
PMID:23111930   PMID:23116433   PMID:23157339   PMID:23197227   PMID:23215821   PMID:23247077   PMID:23313272   PMID:23319006   PMID:23344637   PMID:23391042   PMID:23449091   PMID:23480342  
PMID:23499704   PMID:23544600   PMID:23548774   PMID:23627963   PMID:23707423   PMID:23726513   PMID:23738520   PMID:23742855   PMID:23746491   PMID:23746540   PMID:23755928   PMID:23761378  
PMID:23786983   PMID:23866280   PMID:23881096   PMID:23888755   PMID:24008922   PMID:24169519   PMID:24229476   PMID:24244526   PMID:24247011   PMID:24252804   PMID:24286237   PMID:24291416  
PMID:24314147   PMID:24326626   PMID:24355137   PMID:24360188   PMID:24422758   PMID:24443391   PMID:24451655   PMID:24494688   PMID:24510409   PMID:24607627   PMID:24652311   PMID:24671068  
PMID:24791650   PMID:24805005   PMID:24809685   PMID:24865426   PMID:24889756   PMID:24902785   PMID:24971323   PMID:24983833   PMID:25028974   PMID:25060544   PMID:25082653   PMID:25198178  
PMID:25326468   PMID:25331606   PMID:25349169   PMID:25389533   PMID:25398695   PMID:25497297   PMID:25502632   PMID:25510658   PMID:25522433   PMID:25604428   PMID:25618115   PMID:25623016  
PMID:25655492   PMID:25660313   PMID:25671411   PMID:25708001   PMID:25747527   PMID:25777072   PMID:25784069   PMID:25793616   PMID:25794322   PMID:25809512   PMID:25810277   PMID:25826396  
PMID:25857233   PMID:26015071   PMID:26035919   PMID:26051160   PMID:26081301   PMID:26081309   PMID:26101773   PMID:26174679   PMID:26196864   PMID:26227907   PMID:26228323   PMID:26447226  
PMID:26449393   PMID:26481676   PMID:26494873   PMID:26546820   PMID:26620113   PMID:26632697   PMID:26633268   PMID:26698543   PMID:26851573   PMID:26871599   PMID:26908392   PMID:26932718  
PMID:26945458   PMID:27018532   PMID:27045843   PMID:27160004   PMID:27190576   PMID:27300740   PMID:27499296   PMID:27614969   PMID:27821364   PMID:27823806   PMID:27866207   PMID:28031080  
PMID:28044091   PMID:28119174   PMID:28163169   PMID:28181067   PMID:28292438   PMID:28345608   PMID:28402333   PMID:28416295   PMID:28418735   PMID:28514442   PMID:28577058   PMID:28603901  
PMID:28611215   PMID:28670115   PMID:28712090   PMID:28851912   PMID:28858992   PMID:28982350   PMID:29019036   PMID:29050386   PMID:29186431   PMID:29222910   PMID:29361339   PMID:29478144  
PMID:29505805   PMID:29542091   PMID:29600412   PMID:29602729   PMID:29637670   PMID:29712944   PMID:29730831   PMID:29746646   PMID:29844571   PMID:29952131   PMID:30021838   PMID:30021884  
PMID:30092258   PMID:30126429   PMID:30242221   PMID:30336354   PMID:30338484   PMID:30344263   PMID:30456877   PMID:30465982   PMID:30639342   PMID:30656852   PMID:30794821   PMID:30804379  
PMID:30809547   PMID:30943524   PMID:31051081   PMID:31091453   PMID:31291228   PMID:31314763   PMID:31441562   PMID:31448578   PMID:31556016   PMID:31647557   PMID:31721380   PMID:31754354  
PMID:31931023   PMID:32066880   PMID:32241179   PMID:32273550   PMID:32457219   PMID:32877691   PMID:33212830   PMID:33264068   PMID:33362272   PMID:33513133   PMID:33807669  


Genomics

Comparative Map Data
MAOA
(Homo sapiens - human)
Human AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCh38.p13 EnsemblX43,654,907 - 43,746,824 (+)EnsemblGRCh38hg38GRCh38
GRCh38X43,655,006 - 43,746,817 (+)NCBIGRCh38GRCh38hg38GRCh38
GRCh37X43,514,254 - 43,606,064 (+)NCBIGRCh37GRCh37hg19GRCh37
Build 36X43,400,353 - 43,491,012 (+)NCBINCBI36hg18NCBI36
Build 34X43,271,662 - 43,362,321NCBI
CeleraX47,658,765 - 47,745,839 (+)NCBI
Cytogenetic MapXp11.3NCBI
HuRefX41,244,782 - 41,335,636 (+)NCBIHuRef
CHM1_1X43,547,315 - 43,639,233 (+)NCBICHM1_1
Maoa
(Mus musculus - house mouse)
Mouse AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
GRCm39X16,485,937 - 16,554,051 (+)NCBIGRCm39mm39
GRCm39 EnsemblX16,485,937 - 16,554,057 (+)Ensembl
GRCm38X16,619,698 - 16,687,812 (+)NCBIGRCm38GRCm38mm10GRCm38
GRCm38.p6 EnsemblX16,619,698 - 16,687,818 (+)EnsemblGRCm38mm10GRCm38
MGSCv37X16,196,824 - 16,264,938 (+)NCBIGRCm37mm9NCBIm37
MGSCv36X15,776,657 - 15,844,677 (+)NCBImm8
CeleraX14,235,521 - 14,303,664 (+)NCBICelera
Cytogenetic MapXA1.2NCBI
cM MapX11.78NCBI
Maoa
(Rattus norvegicus - Norway rat)
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
mRatBN7.2X6,032,172 - 6,098,308 (-)NCBI
Rnor_6.0 EnsemblX6,554,698 - 6,620,722 (-)EnsemblRnor6.0rn6Rnor6.0
Rnor_6.0X6,554,698 - 6,620,722 (-)NCBIRnor6.0Rnor_6.0rn6Rnor6.0
Rnor_5.0X7,373,101 - 7,439,125 (-)NCBIRnor5.0Rnor_5.0rn5Rnor5.0
RGSC_v3.4X17,678,960 - 17,745,908 (-)NCBIRGSC3.4rn4RGSC3.4
RGSC_v3.1X17,731,861 - 17,799,225 (-)NCBI
CeleraX6,522,076 - 6,588,367 (-)NCBICelera
Cytogenetic MapXq11NCBI
Maoa
(Chinchilla lanigera - long-tailed chinchilla)
Chinchilla AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChiLan1.0 EnsemblNW_0049555164,493,946 - 4,576,317 (-)EnsemblChiLan1.0
ChiLan1.0NW_0049555164,494,133 - 4,576,317 (-)NCBIChiLan1.0ChiLan1.0
MAOA
(Pan paniscus - bonobo/pygmy chimpanzee)
Bonobo AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
PanPan1.1X43,931,198 - 44,022,199 (+)NCBIpanpan1.1PanPan1.1panPan2
PanPan1.1 EnsemblX43,931,044 - 44,022,199 (+)Ensemblpanpan1.1panPan2
Mhudiblu_PPA_v0X36,106,680 - 36,197,907 (+)NCBIMhudiblu_PPA_v0panPan3
MAOA
(Canis lupus familiaris - dog)
Dog AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
CanFam3.1X37,678,933 - 37,744,757 (+)NCBICanFam3.1CanFam3.1canFam3CanFam3.1
CanFam3.1 EnsemblX37,677,493 - 37,744,757 (+)EnsemblCanFam3.1canFam3CanFam3.1
Dog10K_Boxer_TashaX24,906,697 - 24,972,819 (+)NCBI
ROS_Cfam_1.0X37,766,823 - 37,832,990 (+)NCBI
UMICH_Zoey_3.1X37,808,131 - 37,874,259 (+)NCBI
UNSW_CanFamBas_1.0X37,790,918 - 37,857,220 (+)NCBI
UU_Cfam_GSD_1.0X37,886,004 - 37,952,154 (+)NCBI
Maoa
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)
Squirrel AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HiC_Itri_2X29,974,871 - 30,047,257 (+)NCBI
SpeTri2.0NW_0049365029,816,443 - 9,888,002 (+)NCBISpeTri2.0SpeTri2.0SpeTri2.0
MAOA
(Sus scrofa - pig)
Pig AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Sscrofa11.1X38,930,452 - 39,006,220 (+)NCBISscrofa11.1Sscrofa11.1susScr11Sscrofa11.1
Sscrofa10.2X43,132,736 - 43,208,694 (-)NCBISscrofa10.2Sscrofa10.2susScr3
MAOA
(Chlorocebus sabaeus - African green monkey)
Vervet AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
ChlSab1.1X40,834,158 - 40,920,404 (+)NCBI
ChlSab1.1 EnsemblX40,834,159 - 40,920,444 (+)Ensembl
Maoa
(Heterocephalus glaber - naked mole-rat)
Molerat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
HetGla 1.0NW_00462476211,743,833 - 11,820,529 (-)NCBI

Position Markers
GDB:313553  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,524,971 - 43,525,142UniSTSGRCh37
Build 36X43,409,915 - 43,410,086RGDNCBI36
CeleraX47,668,331 - 47,668,502RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,255,632 - 41,255,799UniSTS
STS-AA035648  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,604,553 - 43,604,758UniSTSGRCh37
Build 36X43,489,497 - 43,489,702RGDNCBI36
CeleraX47,744,324 - 47,744,529RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,334,118 - 41,334,323UniSTS
GeneMap99-GB4 RH MapX116.53UniSTS
NCBI RH MapX152.1UniSTS
DXS8277  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,603,825 - 43,604,028UniSTSGRCh37
Build 36X43,488,769 - 43,488,972RGDNCBI36
CeleraX47,743,596 - 47,743,799RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,333,390 - 41,333,593UniSTS
Stanford-G3 RH MapX1690.0UniSTS
GeneMap99-G3 RH MapX892.0UniSTS
GDB:178075  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,551,222 - 43,551,338UniSTSGRCh37
Build 36X43,436,166 - 43,436,282RGDNCBI36
CeleraX47,694,589 - 47,694,705RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,281,690 - 41,281,802UniSTS
MAOA  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X19,377,677 - 19,377,853UniSTSGRCh37
GRCh37X43,603,360 - 43,604,012UniSTSGRCh37
GRCh37X43,590,506 - 43,591,084UniSTSGRCh37
Build 36X43,488,304 - 43,488,956RGDNCBI36
CeleraX47,730,277 - 47,730,855UniSTS
CeleraX47,743,131 - 47,743,783RGD
CeleraX23,499,013 - 23,499,189UniSTS
Cytogenetic MapXp11.3UniSTS
HuRefX41,320,066 - 41,320,644UniSTS
HuRefX41,332,925 - 41,333,577UniSTS
HuRefX17,126,853 - 17,127,029UniSTS
GDB:189507  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,516,264 - 43,516,596UniSTSGRCh37
Build 36X43,401,208 - 43,401,540RGDNCBI36
CeleraX47,659,620 - 47,659,956RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,246,921 - 41,247,257UniSTS
GDB:191609  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,603,359 - 43,603,846UniSTSGRCh37
Build 36X43,488,303 - 43,488,790RGDNCBI36
CeleraX47,743,130 - 47,743,617RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,332,924 - 41,333,411UniSTS
GDB:191610  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,590,970 - 43,591,099UniSTSGRCh37
Build 36X43,475,914 - 43,476,043RGDNCBI36
CeleraX47,730,741 - 47,730,870RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,320,530 - 41,320,659UniSTS
PMC130047P4  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,514,243 - 43,514,566UniSTSGRCh37
Build 36X43,399,187 - 43,399,510RGDNCBI36
CeleraX47,657,599 - 47,657,922RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,244,870 - 41,245,223UniSTS
MAOA_1352  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,605,277 - 43,606,127UniSTSGRCh37
Build 36X43,490,221 - 43,491,071RGDNCBI36
CeleraX47,745,048 - 47,745,898RGD
HuRefX41,334,843 - 41,335,692UniSTS
DXS7156  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,605,921 - 43,606,038UniSTSGRCh37
Build 36X43,490,865 - 43,490,982RGDNCBI36
CeleraX47,745,692 - 47,745,809RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,335,486 - 41,335,603UniSTS
AFMa040yf9  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,535,938 - 43,536,187UniSTSGRCh37
Build 36X43,420,882 - 43,421,131RGDNCBI36
CeleraX47,679,301 - 47,679,550RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,266,402 - 41,266,651UniSTS
Whitehead-RH MapX46.9UniSTS
WI-19024  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,603,774 - 43,604,054UniSTSGRCh37
Build 36X43,488,718 - 43,488,998RGDNCBI36
CeleraX47,743,545 - 47,743,825RGD
Cytogenetic MapXp11.3UniSTS
HuRefX41,333,339 - 41,333,619UniSTS
GeneMap99-GB4 RH MapX130.56UniSTS
Whitehead-RH MapX45.4UniSTS
NCBI RH MapX157.4UniSTS
LAMP2  
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh37X43,600,172 - 43,600,280UniSTSGRCh37
Build 36X43,485,116 - 43,485,224RGDNCBI36
CeleraX47,739,942 - 47,740,050RGD
HuRefX41,329,736 - 41,329,844UniSTS

miRNA Target Status

Predicted Target Of
Summary Value
Count of predictions:2798
Count of miRNA genes:1074
Interacting mature miRNAs:1296
Transcripts:ENST00000338702, ENST00000490604, ENST00000497485, ENST00000542639
Prediction methods:Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.


Expression


RNA-SEQ Expression
High: > 1000 TPM value   Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM   Below Cutoff: < 0.5 TPM

alimentary part of gastrointestinal system circulatory system endocrine system exocrine system hemolymphoid system hepatobiliary system integumental system musculoskeletal system nervous system renal system reproductive system respiratory system sensory system visual system adipose tissue appendage entire extraembryonic component
High
Medium 2348 2132 1403 598 393 439 3666 1613 2409 357 979 1448 167 1203 2365 2
Low 63 641 310 21 737 22 666 569 1284 47 437 110 3 1 421 2
Below cutoff 18 212 9 3 323 3 18 10 13 11 28 37 3 1 2 1

Sequence

Nucleotide Sequences
RefSeq Transcripts NG_008957 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NM_001270458 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB042829 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AH002871 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AJ004833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK223499 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK291769 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK293926 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL020990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL109855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY684850 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY684858 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY685682 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY685685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC008064 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC044787 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BG534382 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BT006651 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BU684121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX501303 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX530072 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471141 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ314615 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KR137528 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KR817800 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KT428694 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KT428695 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KT428696 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KT428697 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  KT428698 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LN813020 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LN813021 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  LN813022 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M68840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M69226 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M89636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S72704 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  S81371 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X17192 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60811 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60813 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X60819 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles

Reference Sequences
RefSeq Acc Id: ENST00000338702   ⟹   ENSP00000340684
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX43,656,219 - 43,746,821 (+)Ensembl
RefSeq Acc Id: ENST00000490604
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX43,743,704 - 43,744,658 (+)Ensembl
RefSeq Acc Id: ENST00000497485
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX43,656,302 - 43,731,382 (+)Ensembl
RefSeq Acc Id: ENST00000542639   ⟹   ENSP00000440846
RefSeq Status:
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38.p13 EnsemblX43,654,907 - 43,746,824 (+)Ensembl
RefSeq Acc Id: NM_000240   ⟹   NP_000231
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X43,656,299 - 43,746,817 (+)NCBI
GRCh37X43,514,155 - 43,606,071 (+)NCBI
Build 36X43,400,353 - 43,491,012 (+)NCBI Archive
HuRefX41,244,782 - 41,335,636 (+)NCBI
CHM1_1X43,547,315 - 43,639,233 (+)NCBI
Sequence:
RefSeq Acc Id: NM_001270458   ⟹   NP_001257387
RefSeq Status: REVIEWED
Type: CODING
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X43,655,006 - 43,746,817 (+)NCBI
HuRefX41,244,782 - 41,335,636 (+)NCBI
CHM1_1X43,547,315 - 43,639,233 (+)NCBI
Sequence:
Reference Sequences
RefSeq Acc Id: NP_000231   ⟸   NM_000240
- Peptide Label: isoform 1
- UniProtKB: P21397 (UniProtKB/Swiss-Prot),   Q49A63 (UniProtKB/TrEMBL),   Q53YE7 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: NP_001257387   ⟸   NM_001270458
- Peptide Label: isoform 2
- UniProtKB: P21397 (UniProtKB/Swiss-Prot),   Q49A63 (UniProtKB/TrEMBL)
- Sequence:
RefSeq Acc Id: ENSP00000440846   ⟸   ENST00000542639
RefSeq Acc Id: ENSP00000340684   ⟸   ENST00000338702
Protein Domains
Amino_oxidase

Promoters
RGD ID:6809020
Promoter ID:HG_KWN:66513
Type:CpG-Island
SO ACC ID:SO:0000170
Source:MPROMDB
Tissues & Cell Lines:CD4+TCell,   CD4+TCell_12Hour
Transcripts:NM_000240,   OTTHUMT00000056301
Position:
Human AssemblyChrPosition (strand)Source
Build 36X43,399,406 - 43,400,407 (+)MPROMDB
RGD ID:13605096
Promoter ID:EPDNEW_H28732
Type:initiation region
Name:MAOA_1
Description:monoamine oxidase A
SO ACC ID:SO:0000170
Source:EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)
Alternative Promoters:null; see alsoEPDNEW_H28731  
Experiment Methods:Single-end sequencing.
Position:
Human AssemblyChrPosition (strand)Source
GRCh38X43,656,303 - 43,656,363EPDNEW

Clinical Variants
Name Type Condition(s) Position(s) Clinical significance
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x3 copy number gain See cases [RCV000133911] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|likely pathogenic|conflicting data from submitters
NM_000240.3(MAOA):c.424G>T (p.Ala142Ser) single nucleotide variant not provided [RCV000521981] ChrX:43712717 [GRCh38]
ChrX:43571964 [GRCh37]
ChrX:Xp11.3
uncertain significance
NM_000240.3(MAOA):c.886C>T (p.Gln296Ter) single nucleotide variant Brunner syndrome [RCV000010645] ChrX:43731784 [GRCh38]
ChrX:43591031 [GRCh37]
ChrX:Xp11.3
pathogenic
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) microsatellite Antisocial behavior, susceptibility to [RCV000010646]|Autism, severe [RCV000010647] ChrX:43655101..43655130 [GRCh38]
ChrX:43514349..43514378 [GRCh37]
ChrX:Xp11.3
pathogenic|risk factor
GRCh38/hg38 Xp22.33-q28(chrX:3092486-155699618)x2 copy number gain See cases [RCV000050889] ChrX:3092486..155699618 [GRCh38]
ChrX:3010527..154929279 [GRCh37]
ChrX:3020527..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x3 copy number gain See cases [RCV000050810] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20140-155699618)x1 copy number loss See cases [RCV000050811] ChrX:20140..155699618 [GRCh38]
ChrX:70140..154929279 [GRCh37]
ChrX:10140..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000050699] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050385]|See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss Global developmental delay [RCV000050386]|See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000050697] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52809182)x1 copy number loss See cases [RCV000051026] ChrX:10679..52809182 [GRCh38]
ChrX:60679..52838206 [GRCh37]
ChrX:679..52854931 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26101-155999293)x3 copy number gain See cases [RCV000052322] ChrX:26101..155999293 [GRCh38]
ChrX:76101..155228958 [GRCh37]
ChrX:16101..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2790845-155699618)x3 copy number gain See cases [RCV000052359] ChrX:2790845..155699618 [GRCh38]
ChrX:2708886..154929279 [GRCh37]
ChrX:2718886..154582473 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:237659-156022362)x3 copy number gain Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052327]|See cases [RCV000052327] ChrX:237659..156022362 [GRCh38]
ChrX:154326..155252027 [GRCh37]
ChrX:94326..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:27245-155996431)x3 copy number gain See cases [RCV000052324] ChrX:27245..155996431 [GRCh38]
ChrX:77245..155226096 [GRCh37]
ChrX:17245..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.3(chrX:675360-46016699)x3 copy number gain See cases [RCV000052328] ChrX:675360..46016699 [GRCh38]
ChrX:636095..45876134 [GRCh37]
ChrX:556095..45761078 [NCBI36]
ChrX:Xp22.33-11.3
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40704-156022362)x3 copy number gain See cases [RCV000052325] ChrX:40704..156022362 [GRCh38]
ChrX:90704..155252027 [GRCh37]
ChrX:30704..154905221 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp11.4-11.23(chrX:41434043-47880733)x1 copy number loss See cases [RCV000053088] ChrX:41434043..47880733 [GRCh38]
ChrX:41293296..47619970 [GRCh37]
ChrX:41178240..47625076 [NCBI36]
ChrX:Xp11.4-11.23
pathogenic
GRCh38/hg38 Xp11.4-11.3(chrX:41823849-44240337)x1 copy number loss See cases [RCV000053092] ChrX:41823849..44240337 [GRCh38]
ChrX:41683102..44099583 [GRCh37]
ChrX:41568046..43984527 [NCBI36]
ChrX:Xp11.4-11.3
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss Global developmental delay [RCV000052986]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|Intellectual functioning disability [RCV000052988]|Global developmental delay [RCV000052989]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052987]|See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q22.1(chrX:675360-100368517)x1 copy number loss See cases [RCV000053005] ChrX:675360..100368517 [GRCh38]
ChrX:636095..99623515 [GRCh37]
ChrX:556095..99510171 [NCBI36]
ChrX:Xp22.33-q22.1
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-48344725)x1 copy number loss See cases [RCV000052981] ChrX:10679..48344725 [GRCh38]
ChrX:60679..48204160 [GRCh37]
ChrX:679..48089104 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss Hypoplastic left heart [RCV000052982]|See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:26102-57302794)x1 copy number loss See cases [RCV000052990] ChrX:26102..57302794 [GRCh38]
ChrX:76102..57329227 [GRCh37]
ChrX:16102..57345952 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-11.1(chrX:253129-58271563)x1 copy number loss See cases [RCV000052994] ChrX:253129..58271563 [GRCh38]
ChrX:169796..58297997 [GRCh37]
ChrX:109796..58314722 [NCBI36]
ChrX:Xp22.33-11.1
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:2769041-58055036)x1 copy number loss See cases [RCV000053007] ChrX:2769041..58055036 [GRCh38]
ChrX:2687082..58081470 [GRCh37]
ChrX:2697082..58098195 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain Global developmental delay [RCV000052984]|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052985]|See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:10679-55550898)x1 copy number loss Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052971]|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052971]|See cases [RCV000052971] ChrX:10679..55550898 [GRCh38]
ChrX:60679..55577331 [GRCh37]
ChrX:679..55594056 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10479-54179172)x3 copy number gain See cases [RCV000053817] ChrX:10479..54179172 [GRCh38]
ChrX:60479..53957191 [GRCh37]
ChrX:479..54222330 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
NM_000240.3(MAOA):c.1410T>C (p.Asp470=) single nucleotide variant History of neurodevelopmental disorder [RCV000715341]|not specified [RCV000078414] ChrX:43744144 [GRCh38]
ChrX:43603391 [GRCh37]
ChrX:Xp11.3
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_000240.3(MAOA):c.891G>T (p.Arg297=) single nucleotide variant History of neurodevelopmental disorder [RCV000715347]|not specified [RCV000078415] ChrX:43731789 [GRCh38]
ChrX:43591036 [GRCh37]
ChrX:Xp11.3
benign|conflicting interpretations of pathogenicity|conflicting data from submitters
NM_000240.3(MAOA):c.385A>C (p.Arg129=) single nucleotide variant History of neurodevelopmental disorder [RCV000715310]|not specified [RCV000117593] ChrX:43711950 [GRCh38]
ChrX:43571197 [GRCh37]
ChrX:Xp11.3
benign|likely benign|conflicting interpretations of pathogenicity
NM_000240.3(MAOA):c.797G>T (p.Cys266Phe) single nucleotide variant Brunner syndrome [RCV000128399] ChrX:43731695 [GRCh38]
ChrX:43590942 [GRCh37]
ChrX:Xp11.3
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022826)x4 copy number gain See cases [RCV000133654] ChrX:10679..156022826 [GRCh38]
ChrX:60679..155252491 [GRCh37]
ChrX:679..154905685 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.825G>A (p.Pro275=) single nucleotide variant Brunner syndrome [RCV000638567]|History of neurodevelopmental disorder [RCV000717248]|not specified [RCV000180115] ChrX:43731723 [GRCh38]
ChrX:43590970 [GRCh37]
ChrX:Xp11.3
benign|likely benign|conflicting interpretations of pathogenicity
GRCh37/hg19 Xp22.33-11.21(chrX:70297-58066465)x3 copy number gain See cases [RCV000239834] ChrX:70297..58066465 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-155978689)x1 copy number loss See cases [RCV000133792] ChrX:10701..155978689 [GRCh38]
ChrX:60701..155208354 [GRCh37]
ChrX:701..154861548 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-52857805)x1 copy number loss See cases [RCV000133817] ChrX:10701..52857805 [GRCh38]
ChrX:60701..52886834 [GRCh37]
ChrX:701..52903559 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x3 copy number gain See cases [RCV000050385] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156013167)x1 copy number loss See cases [RCV000050386] ChrX:10679..156013167 [GRCh38]
ChrX:60679..155242832 [GRCh37]
ChrX:679..154896026 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:14245-155999293)x1 copy number loss See cases [RCV000052982] ChrX:14245..155999293 [GRCh38]
ChrX:64245..155228958 [GRCh37]
ChrX:4245..154882152 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x3 copy number gain See cases [RCV000052984] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:26102-155996431)x1 copy number loss See cases [RCV000052986] ChrX:26102..155996431 [GRCh38]
ChrX:76102..155226096 [GRCh37]
ChrX:16102..154879290 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NC_000023.10:g.(?_43479884)_(46741003_?)del deletion Kabuki syndrome 2 [RCV000172943] ChrX:43479884..46741003 [GRCh37]
ChrX:Xp11.3-11.23
likely pathogenic
NC_000023.10:g.(?_43479884)_(45501849_?)del deletion Kabuki syndrome 2 [RCV000172944] ChrX:43479884..45501849 [GRCh37]
ChrX:Xp11.3
likely pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-50059388)x1 copy number loss See cases [RCV000133745] ChrX:10679..50059388 [GRCh38]
ChrX:60679..49824045 [GRCh37]
ChrX:679..49710785 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-155999253)x3 copy number gain See cases [RCV000134564] ChrX:20297..155999253 [GRCh38]
ChrX:70297..155228918 [GRCh37]
ChrX:10297..154882112 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q11.1(chrX:10701-62712219)x1 copy number loss See cases [RCV000134568] ChrX:10701..62712219 [GRCh38]
ChrX:60701..61931689 [GRCh37]
ChrX:701..61848414 [NCBI36]
ChrX:Xp22.33-q11.1
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:10701-58055053)x1 copy number loss See cases [RCV000134026] ChrX:10701..58055053 [GRCh38]
ChrX:60701..58081487 [GRCh37]
ChrX:701..58098212 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003242)x1 copy number loss See cases [RCV000133947] ChrX:10701..156003242 [GRCh38]
ChrX:60701..155232907 [GRCh37]
ChrX:701..154886101 [NCBI36]
ChrX:Xp22.33-q28
pathogenic|conflicting interpretations of pathogenicity|conflicting data from submitters
GRCh38/hg38 Xp21.1-q28(chrX:37076284-156016920)x1 copy number loss See cases [RCV000135300] ChrX:37076284..156016920 [GRCh38]
ChrX:37094357..155246585 [GRCh37]
ChrX:37004278..154899779 [NCBI36]
ChrX:Xp21.1-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-156026127)x1 copy number loss See cases [RCV000135321] ChrX:20297..156026127 [GRCh38]
ChrX:70297..155255792 [GRCh37]
ChrX:10297..154908986 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.31-11.22(chrX:8176030-53962833)x1 copy number loss See cases [RCV000135305] ChrX:8176030..53962833 [GRCh38]
ChrX:8144071..53989266 [GRCh37]
ChrX:8104071..54005991 [NCBI36]
ChrX:Xp22.31-11.22
pathogenic
GRCh38/hg38 Xp11.3(chrX:43640608-44123496)x2 copy number gain See cases [RCV000135327] ChrX:43640608..44123496 [GRCh38]
ChrX:43499856..43982742 [GRCh37]
ChrX:43384800..43867686 [NCBI36]
ChrX:Xp11.3
pathogenic
GRCh38/hg38 Xp11.3-11.22(chrX:43361870-50931794)x3 copy number gain See cases [RCV000134956] ChrX:43361870..50931794 [GRCh38]
ChrX:43221119..50674794 [GRCh37]
ChrX:43106063..50691534 [NCBI36]
ChrX:Xp11.3-11.22
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52857805)x3 copy number gain See cases [RCV000134957] ChrX:10679..52857805 [GRCh38]
ChrX:60679..52886834 [GRCh37]
ChrX:679..52903559 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp11.3(chrX:43573663-44655459)x3 copy number gain See cases [RCV000135763] ChrX:43573663..44655459 [GRCh38]
ChrX:43432911..44514705 [GRCh37]
ChrX:43317855..44399649 [NCBI36]
ChrX:Xp11.3
uncertain significance
GRCh38/hg38 Xp11.4-11.3(chrX:42217978-43846754)x0 copy number loss See cases [RCV000135780] ChrX:42217978..43846754 [GRCh38]
ChrX:42077231..43706000 [GRCh37]
ChrX:41962175..43590944 [NCBI36]
ChrX:Xp11.4-11.3
pathogenic|likely pathogenic|uncertain significance
GRCh38/hg38 Xp21.1-q28(chrX:36237706-156022206)x1 copy number loss See cases [RCV000135552] ChrX:36237706..156022206 [GRCh38]
ChrX:36255823..155251871 [GRCh37]
ChrX:36165744..154905065 [NCBI36]
ChrX:Xp21.1-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:40904-155998166)x1 copy number loss See cases [RCV000136478] ChrX:40904..155998166 [GRCh38]
ChrX:90904..155227831 [GRCh37]
ChrX:30904..154881025 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x1 copy number loss See cases [RCV000136097] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q25(chrX:10701-128393708) copy number loss See cases [RCV000136094] ChrX:10701..128393708 [GRCh38]
ChrX:60701..127527686 [GRCh37]
ChrX:701..127355367 [NCBI36]
ChrX:Xp22.33-q25
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10001-156030895)x1 copy number loss See cases [RCV000136005] ChrX:10001..156030895 [GRCh38]
ChrX:60001..155260560 [GRCh37]
ChrX:1..154913754 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10679-52213731)x1 copy number loss See cases [RCV000137112] ChrX:10679..52213731 [GRCh38]
ChrX:60679..51948998 [GRCh37]
ChrX:679..51973598 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic|uncertain significance
GRCh38/hg38 Xp22.33-q13.3(chrX:10679-76420505)x3 copy number gain See cases [RCV000137137] ChrX:10679..76420505 [GRCh38]
ChrX:60679..75640898 [GRCh37]
ChrX:679..75557302 [NCBI36]
ChrX:Xp22.33-q13.3
pathogenic|likely benign
GRCh38/hg38 Xp22.33-q28(chrX:2782275-155611794)x2 copy number gain See cases [RCV000136841] ChrX:2782275..155611794 [GRCh38]
ChrX:2700316..154785891 [GRCh37]
ChrX:2710316..154494649 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2765636-155522304)x3 copy number gain See cases [RCV000136791] ChrX:2765636..155522304 [GRCh38]
ChrX:2683677..154751965 [GRCh37]
ChrX:2693677..154405159 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-52033734)x1 copy number loss See cases [RCV000137430] ChrX:10701..52033734 [GRCh38]
ChrX:60701..51776830 [GRCh37]
ChrX:701..51793570 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:10701-58055036)x1 copy number loss See cases [RCV000137552] ChrX:10701..58055036 [GRCh38]
ChrX:60701..58081470 [GRCh37]
ChrX:701..58098195 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10679-49157514)x1 copy number loss See cases [RCV000137166] ChrX:10679..49157514 [GRCh38]
ChrX:60679..49016667 [GRCh37]
ChrX:679..48903611 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-11.23(chrX:10701-49071220)x1 copy number loss See cases [RCV000137413] ChrX:10701..49071220 [GRCh38]
ChrX:60701..48928877 [GRCh37]
ChrX:701..48815821 [NCBI36]
ChrX:Xp22.33-11.23
pathogenic
GRCh38/hg38 Xp22.33-q22.3(chrX:10701-106113403)x1 copy number loss See cases [RCV000137886] ChrX:10701..106113403 [GRCh38]
ChrX:60701..105357395 [GRCh37]
ChrX:701..105244051 [NCBI36]
ChrX:Xp22.33-q22.3
pathogenic
GRCh38/hg38 Xp22.2-q27.3(chrX:13020141-143473520)x1 copy number loss See cases [RCV000138678] ChrX:13020141..143473520 [GRCh38]
ChrX:13038260..142561303 [GRCh37]
ChrX:12948181..142388969 [NCBI36]
ChrX:Xp22.2-q27.3
pathogenic
GRCh38/hg38 Xp11.3(chrX:43714151-43720885)x3 copy number gain See cases [RCV000138652] ChrX:43714151..43720885 [GRCh38]
ChrX:43573398..43580132 [GRCh37]
ChrX:43458342..43465076 [NCBI36]
ChrX:Xp11.3
likely benign
GRCh38/hg38 Xp11.3(chrX:43714151-43720885)x2 copy number gain See cases [RCV000138653] ChrX:43714151..43720885 [GRCh38]
ChrX:43573398..43580132 [GRCh37]
ChrX:43458342..43465076 [NCBI36]
ChrX:Xp11.3
likely benign
GRCh38/hg38 Xp22.33-11.1(chrX:10701-58517661)x1 copy number loss See cases [RCV000139343] ChrX:10701..58517661 [GRCh38]
ChrX:60701..58544094 [GRCh37]
ChrX:701..58560819 [NCBI36]
ChrX:Xp22.33-11.1
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:1085618-155699644)x1 copy number loss See cases [RCV000139278] ChrX:1085618..155699644 [GRCh38]
ChrX:1118268..154929305 [GRCh37]
ChrX:1038268..154582499 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q21.31(chrX:10701-88318651)x1 copy number loss See cases [RCV000139352] ChrX:10701..88318651 [GRCh38]
ChrX:60701..87573652 [GRCh37]
ChrX:701..87460308 [NCBI36]
ChrX:Xp22.33-q21.31
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004181)x3 copy number gain See cases [RCV000139888] ChrX:251880..156004181 [GRCh38]
ChrX:168547..155233846 [GRCh37]
ChrX:108547..154887040 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:2299223-155992188)x3 copy number gain See cases [RCV000141400] ChrX:2299223..155992188 [GRCh38]
ChrX:2217264..155221853 [GRCh37]
ChrX:2227264..154875047 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:20297-156016920)x3 copy number gain See cases [RCV000141401] ChrX:20297..156016920 [GRCh38]
ChrX:70297..155246585 [GRCh37]
ChrX:10297..154899779 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x4 copy number gain See cases [RCV000140786] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-53750424)x1 copy number loss See cases [RCV000140711] ChrX:10701..53750424 [GRCh38]
ChrX:60701..53776922 [GRCh37]
ChrX:701..53793647 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x1 copy number loss See cases [RCV000140787] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic|conflicting data from submitters
GRCh38/hg38 Xp22.33-11.22(chrX:251879-50289363)x1 copy number loss See cases [RCV000141741] ChrX:251879..50289363 [GRCh38]
ChrX:168546..50032363 [GRCh37]
ChrX:108546..50049103 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp11.3(chrX:42881484-43748896)x0 copy number loss See cases [RCV000141535] ChrX:42881484..43748896 [GRCh38]
ChrX:42740733..43608143 [GRCh37]
ChrX:42625677..43493087 [NCBI36]
ChrX:Xp11.3
pathogenic
GRCh38/hg38 Xp22.33-q12(chrX:251880-66445845)x1 copy number loss See cases [RCV000142334] ChrX:251880..66445845 [GRCh38]
ChrX:168547..65665687 [GRCh37]
ChrX:108547..65582412 [NCBI36]
ChrX:Xp22.33-q12
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:251880-51643625)x1 copy number loss See cases [RCV000142035] ChrX:251880..51643625 [GRCh38]
ChrX:168547..51386559 [GRCh37]
ChrX:108547..51403299 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q24(chrX:251879-118847157)x3 copy number gain See cases [RCV000142134] ChrX:251879..118847157 [GRCh38]
ChrX:168546..117981120 [GRCh37]
ChrX:108546..117865148 [NCBI36]
ChrX:Xp22.33-q24
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10701-156003229)x3 copy number gain See cases [RCV000142625] ChrX:10701..156003229 [GRCh38]
ChrX:60701..155232894 [GRCh37]
ChrX:701..154886088 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x1 copy number loss See cases [RCV000143441] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:108546..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251879-156004066)x3 copy number gain See cases [RCV000143433] ChrX:251879..156004066 [GRCh38]
ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.22(chrX:10701-53131191)x1 copy number loss See cases [RCV000143348] ChrX:10701..53131191 [GRCh38]
ChrX:60701..53047381 [GRCh37]
ChrX:701..53177098 [NCBI36]
ChrX:Xp22.33-11.22
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:251880-156004066)x3 copy number gain See cases [RCV000143219] ChrX:251880..156004066 [GRCh38]
ChrX:168547..155233731 [GRCh37]
ChrX:108547..154886925 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-11.21(chrX:251879-56428859)x1 copy number loss See cases [RCV000143130] ChrX:251879..56428859 [GRCh38]
ChrX:168546..56455292 [GRCh37]
ChrX:108546..56472017 [NCBI36]
ChrX:Xp22.33-11.21
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x3 copy number gain See cases [RCV000148141] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
GRCh38/hg38 Xp22.33-q28(chrX:10679-156022206)x1 copy number loss See cases [RCV000148135] ChrX:10679..156022206 [GRCh38]
ChrX:60679..155251871 [GRCh37]
ChrX:679..154905065 [NCBI36]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.1079G>A (p.Arg360Gln) single nucleotide variant not specified [RCV000195192] ChrX:43736253 [GRCh38]
ChrX:43595500 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:71267-155246643)x3 copy number gain See cases [RCV000240122] ChrX:71267..155246643 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.749_750insT (p.Ser251fs) insertion Brunner syndrome [RCV000190423] ChrX:43731344..43731345 [GRCh38]
ChrX:43590591..43590592 [GRCh37]
ChrX:Xp11.3
pathogenic
NM_000240.3(MAOA):c.133C>T (p.Arg45Trp) single nucleotide variant Brunner syndrome [RCV000190424] ChrX:43683572 [GRCh38]
ChrX:43542820 [GRCh37]
ChrX:Xp11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:176426-155250222)x3 copy number gain See cases [RCV000239843] ChrX:176426..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:70297-58066465)x1 copy number loss See cases [RCV000239814] ChrX:70297..58066465 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255839)x1 copy number loss See cases [RCV000239832] ChrX:71267..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.2-q28(chrX:13147668-155250222)x3 copy number gain See cases [RCV000239798] ChrX:13147668..155250222 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
NM_000240.3(MAOA):c.137A>G (p.Asp46Gly) single nucleotide variant Inborn genetic diseases [RCV000210598]|not provided [RCV000513424] ChrX:43683576 [GRCh38]
ChrX:43542824 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255839)x3 copy number gain See cases [RCV000239934] ChrX:70297..155255839 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x2 copy number gain See cases [RCV000240106] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.1263-2A>G single nucleotide variant not provided [RCV000520275] ChrX:43743792 [GRCh38]
ChrX:43603039 [GRCh37]
ChrX:Xp11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246271)x3 copy number gain See cases [RCV000239989] ChrX:60701..155246271 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:553069-155233731)x1 copy number loss See cases [RCV000446026] ChrX:553069..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155224766)x1 copy number loss See cases [RCV000239902] ChrX:71267..155224766 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155234036)x2 copy number gain See cases [RCV000239874] ChrX:71267..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:176426-155236656)x3 copy number gain See cases [RCV000240552] ChrX:176426..155236656 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:150002-155234036)x3 copy number gain See cases [RCV000240314] ChrX:150002..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:225816-155234036)x2 copy number gain See cases [RCV000240464] ChrX:225816..155234036 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:2707626-155250222)x2 copy number gain See cases [RCV000240541] ChrX:2707626..155250222 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.1248G>A (p.Met416Ile) single nucleotide variant Brunner syndrome [RCV001297722]|History of neurodevelopmental disorder [RCV000719587]|Inborn genetic diseases [RCV000622832]|not provided [RCV000339688] ChrX:43742033 [GRCh38]
ChrX:43601280 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.2-q25(chrX:11692290-121187337)x2 copy number gain not provided [RCV000488046] ChrX:11692290..121187337 [GRCh37]
ChrX:Xp22.2-q25
uncertain significance
NM_000240.3(MAOA):c.400A>G (p.Met134Val) single nucleotide variant Inborn genetic diseases [RCV000623413] ChrX:43711965 [GRCh38]
ChrX:43571212 [GRCh37]
ChrX:Xp11.3
uncertain significance
NM_000240.3(MAOA):c.795+1G>A single nucleotide variant not specified [RCV000599196] ChrX:43731391 [GRCh38]
ChrX:43590638 [GRCh37]
ChrX:Xp11.3
uncertain significance
Single allele duplication Syndromic X-linked intellectual disability Lubs type [RCV000768455] ChrX:15323210..153542100 [GRCh37]
ChrX:Xp22.2-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-154930047)x3 copy number gain See cases [RCV000449437] ChrX:168546..154930047 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x3 copy number gain See cases [RCV000449330] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.3(chrX:168546-43917011)x3 copy number gain See cases [RCV000449393] ChrX:168546..43917011 [GRCh37]
ChrX:Xp22.33-11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792) copy number loss See cases [RCV000449461] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-55529093)x1 copy number loss See cases [RCV000446584] ChrX:168546..55529093 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-56684082)x1 copy number loss See cases [RCV000447092] ChrX:168546..56684082 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60701-155246225)x3 copy number gain See cases [RCV000446270] ChrX:60701..155246225 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:2703632-155233731)x1 copy number loss See cases [RCV000446712] ChrX:2703632..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.22(chrX:168546-52573789)x1 copy number loss See cases [RCV000447470] ChrX:168546..52573789 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:71267-155255792)x1 copy number loss See cases [RCV000446197] ChrX:71267..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:318707-155224707)x1 copy number loss See cases [RCV000446667] ChrX:318707..155224707 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain See cases [RCV000446932] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155196888)x3 copy number gain See cases [RCV000446310] ChrX:168546..155196888 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.3(chrX:43396992-43626868)x2 copy number gain See cases [RCV000447431] ChrX:43396992..43626868 [GRCh37]
ChrX:Xp11.3
likely benign
GRCh37/hg19 Xp22.33-q28(chrX:168546-155081533)x3 copy number gain See cases [RCV000447253] ChrX:168546..155081533 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168566-155233731)x1 copy number loss See cases [RCV000445720] ChrX:168566..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp21.1-11.3(chrX:36667388-44316141)x1 copy number loss See cases [RCV000446005] ChrX:36667388..44316141 [GRCh37]
ChrX:Xp21.1-11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss See cases [RCV000448393] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792)x4 copy number gain See cases [RCV000448034] ChrX:70297..155255792 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.1(chrX:168546-58140271)x1 copy number loss See cases [RCV000447773] ChrX:168546..58140271 [GRCh37]
ChrX:Xp22.33-11.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:70297-155246585)x1 copy number loss See cases [RCV000448652] ChrX:70297..155246585 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.4-11.3(chrX:40933552-45379179)x2 copy number gain See cases [RCV000448864] ChrX:40933552..45379179 [GRCh37]
ChrX:Xp11.4-11.3
likely pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-55240087)x1 copy number loss See cases [RCV000512136] ChrX:168546..55240087 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
NM_000240.3(MAOA):c.730G>A (p.Val244Ile) single nucleotide variant Brunner syndrome [RCV000496099] ChrX:43731325 [GRCh38]
ChrX:43590572 [GRCh37]
ChrX:Xp11.3
likely pathogenic
NM_000240.3(MAOA):c.515G>A (p.Arg172Gln) single nucleotide variant Brunner syndrome [RCV000638566]|History of neurodevelopmental disorder [RCV000715677]|not specified [RCV000504239] ChrX:43728184 [GRCh38]
ChrX:43587431 [GRCh37]
ChrX:Xp11.3
benign
GRCh37/hg19 Xp22.33-q28(chrX:168547-151304063)x1 copy number loss See cases [RCV000510382] ChrX:168547..151304063 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_001270458.1(MAOA):c.1048_1049delinsAA (p.Ala350Lys) indel not specified [RCV000499855] ChrX:43744376..43744377 [GRCh38]
ChrX:43603623..43603624 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-q23(chrX:168547-112474026)x1 copy number loss See cases [RCV000510419] ChrX:168547..112474026 [GRCh37]
ChrX:Xp22.33-q23
pathogenic
NM_000240.3(MAOA):c.1559A>G (p.Lys520Arg) single nucleotide variant not provided [RCV000884297]|not specified [RCV000502654] ChrX:43744488 [GRCh38]
ChrX:43603735 [GRCh37]
ChrX:Xp11.3
benign|uncertain significance
NM_000240.3(MAOA):c.330C>T (p.Gly110=) single nucleotide variant History of neurodevelopmental disorder [RCV000718348]|not specified [RCV000500762] ChrX:43711895 [GRCh38]
ChrX:43571142 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.1498G>A (p.Gly500Ser) single nucleotide variant not specified [RCV000500894] ChrX:43744427 [GRCh38]
ChrX:43603674 [GRCh37]
ChrX:Xp11.3
uncertain significance
NM_000240.3(MAOA):c.412-6C>G single nucleotide variant not specified [RCV000503138] ChrX:43712699 [GRCh38]
ChrX:43571946 [GRCh37]
ChrX:Xp11.3
likely benign
GRCh37/hg19 Xp22.33-11.1(chrX:168546-58527164)x1 copy number loss See cases [RCV000510437] ChrX:168546..58527164 [GRCh37]
ChrX:Xp22.33-11.1
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-57504183)x1 copy number loss See cases [RCV000511615] ChrX:168546..57504183 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-57683964)x1 copy number loss See cases [RCV000512022] ChrX:168546..57683964 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp21.1-q22.1(chrX:37521774-98488534)x1 copy number loss See cases [RCV000512026] ChrX:37521774..98488534 [GRCh37]
ChrX:Xp21.1-q22.1
pathogenic
GRCh37/hg19 Xp11.4-11.23(chrX:41150139-46528262)x1 copy number loss See cases [RCV000511364] ChrX:41150139..46528262 [GRCh37]
ChrX:Xp11.4-11.23
pathogenic
GRCh37/hg19 Xp21.2-q28(chrX:31088082-155233731)x1 copy number loss See cases [RCV000511413] ChrX:31088082..155233731 [GRCh37]
ChrX:Xp21.2-q28
pathogenic
NM_000240.3(MAOA):c.95T>C (p.Leu32Ser) single nucleotide variant not provided [RCV000493079] ChrX:43683534 [GRCh38]
ChrX:43542782 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-q28(chrX:168547-155233731) copy number gain See cases [RCV000512020] ChrX:168547..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168546-54996659)x1 copy number loss See cases [RCV000510822] ChrX:168546..54996659 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-q13.3(chrX:168546-74549686) copy number loss See cases [RCV000512142] ChrX:168546..74549686 [GRCh37]
ChrX:Xp22.33-q13.3
pathogenic
GRCh37/hg19 Xp22.33-11.21(chrX:168564-57413442)x1 copy number loss See cases [RCV000512339] ChrX:168564..57413442 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
NM_000240.3(MAOA):c.1385G>A (p.Gly462Asp) single nucleotide variant History of neurodevelopmental disorder [RCV000719838] ChrX:43744119 [GRCh38]
ChrX:43603366 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.23(chrX:168546-46908284)x1 copy number loss not provided [RCV000684185] ChrX:168546..46908284 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
GRCh37/hg19 Xp22.31-q21.31(chrX:7841947-90815333)x1,2 copy number gain not provided [RCV000684261] ChrX:7841947..90815333 [GRCh37]
ChrX:Xp22.31-q21.31
pathogenic
GRCh37/hg19 Xp11.3(chrX:43396992-43626868)x2 copy number gain not provided [RCV000684323] ChrX:43396992..43626868 [GRCh37]
ChrX:Xp11.3
uncertain significance
NM_000240.3(MAOA):c.402G>A (p.Met134Ile) single nucleotide variant Brunner syndrome [RCV000692394] ChrX:43711967 [GRCh38]
ChrX:43571214 [GRCh37]
ChrX:Xp11.3
uncertain significance
NM_000240.3(MAOA):c.890G>A (p.Arg297Gln) single nucleotide variant Brunner syndrome [RCV000687457] ChrX:43731788 [GRCh38]
ChrX:43591035 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.21(chrX:60814-55476165)x1 copy number loss not provided [RCV000753275] ChrX:60814..55476165 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp22.33-11.23(chrX:60814-48317386)x1 copy number loss not provided [RCV000753273] ChrX:60814..48317386 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
GRCh37/hg19 Xp22.33-11.22(chrX:60814-51821765)x1 copy number loss not provided [RCV000753274] ChrX:60814..51821765 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60814-155254881)x2 copy number gain not provided [RCV000753277] ChrX:60814..155254881 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x1 copy number loss not provided [RCV000753271] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60262-155245765)x3 copy number gain not provided [RCV000753272] ChrX:60262..155245765 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:181779-155171702)x1 copy number loss not provided [RCV000753278] ChrX:181779..155171702 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:60814-155236712)x2 copy number gain not provided [RCV000753276] ChrX:60814..155236712 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
Single allele duplication Autistic disorder of childhood onset [RCV000754365] ChrX:1..156040895 [GRCh38]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.702C>T (p.Leu234=) single nucleotide variant Brunner syndrome [RCV000895896] ChrX:43731297 [GRCh38]
ChrX:43590544 [GRCh37]
ChrX:Xp11.3
likely benign
NC_000023.10:g.36649710_136649711del100000002insG indel Heterotaxy, visceral, 1, X-linked [RCV000754886] ChrX:36649710..136649711 [GRCh37]
ChrX:Xp21.1-q26.3
pathogenic
NM_000240.4(MAOA):c.963T>C (p.Cys321=) single nucleotide variant not provided [RCV000999408] ChrX:43732706 [GRCh38]
ChrX:43591953 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.1488C>G (p.Pro496=) single nucleotide variant not provided [RCV000975404] ChrX:43744417 [GRCh38]
ChrX:43603664 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.255C>G (p.Gly85=) single nucleotide variant not provided [RCV000900872] ChrX:43693377 [GRCh38]
ChrX:43552624 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.1311T>A (p.Thr437=) single nucleotide variant not provided [RCV000921248] ChrX:43743842 [GRCh38]
ChrX:43603089 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.1526C>T (p.Thr509Ile) single nucleotide variant not provided [RCV000901482] ChrX:43744455 [GRCh38]
ChrX:43603702 [GRCh37]
ChrX:Xp11.3
likely benign
46,Y,inv(X)(p21.1q13.3) inversion Elevated serum creatine phosphokinase [RCV000856573] ChrX:32196272..75245806 [GRCh37]
ChrX:Xp21.1-q13.3
likely pathogenic
GRCh37/hg19 Xp11.3-11.23(chrX:43507300-48929622) copy number gain not provided [RCV000767648] ChrX:43507300..48929622 [GRCh37]
ChrX:Xp11.3-11.23
pathogenic
NM_000240.3(MAOA):c.1053-10C>G single nucleotide variant not provided [RCV000941525] ChrX:43736217 [GRCh38]
ChrX:43595464 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.732C>T (p.Val244=) single nucleotide variant not provided [RCV000894384] ChrX:43731327 [GRCh38]
ChrX:43590574 [GRCh37]
ChrX:Xp11.3
likely benign
Single allele deletion Neurodevelopmental disorder [RCV000787440] ChrX:1..47140860 [GRCh37]
ChrX:Xp22.33-11.23
pathogenic
NM_000240.3(MAOA):c.260A>G (p.Glu87Gly) single nucleotide variant Brunner syndrome [RCV000805433] ChrX:43693382 [GRCh38]
ChrX:43552629 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.22(chrX:60814-50519984)x1 copy number loss See cases [RCV000790583] ChrX:60814..50519984 [GRCh37]
ChrX:Xp22.33-11.22
pathogenic
NM_000240.3(MAOA):c.3G>A (p.Met1Ile) single nucleotide variant Brunner syndrome [RCV000800325] ChrX:43656344 [GRCh38]
ChrX:43515592 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp11.4-q21.32(chrX:40572613-92796528)x1 copy number loss not provided [RCV000845670] ChrX:40572613..92796528 [GRCh37]
ChrX:Xp11.4-q21.32
pathogenic
GRCh37/hg19 Xp22.33-q11.1(chrX:168546-61877279)x1 copy number loss not provided [RCV000846273] ChrX:168546..61877279 [GRCh37]
ChrX:Xp22.33-q11.1
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1 copy number loss not provided [RCV000848828] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
GRCh37/hg19 Xp11.4-11.3(chrX:42165435-43684005)x0 copy number loss not provided [RCV000845740] ChrX:42165435..43684005 [GRCh37]
ChrX:Xp11.4-11.3
pathogenic
GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4 copy number gain not provided [RCV000846039] ChrX:168546..155233731 [GRCh37]
ChrX:Xp22.33-q28
pathogenic
NM_000240.3(MAOA):c.168+11_168+15del deletion Brunner syndrome [RCV000892021] ChrX:43683617..43683621 [GRCh38]
ChrX:43542865..43542869 [GRCh37]
ChrX:Xp11.3
benign
NM_000240.3(MAOA):c.816G>A (p.Ala272=) single nucleotide variant Brunner syndrome [RCV000907153] ChrX:43731714 [GRCh38]
ChrX:43590961 [GRCh37]
ChrX:Xp11.3
benign
NM_000240.3(MAOA):c.1545G>T (p.Gly515=) single nucleotide variant Brunner syndrome [RCV000903023] ChrX:43744474 [GRCh38]
ChrX:43603721 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.30G>A (p.Ala10=) single nucleotide variant not provided [RCV000932605] ChrX:43656371 [GRCh38]
ChrX:43515619 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.74-6C>T single nucleotide variant Brunner syndrome [RCV000948150] ChrX:43683507 [GRCh38]
ChrX:43542755 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.3(MAOA):c.282T>C (p.Ser94=) single nucleotide variant not provided [RCV000933304] ChrX:43693404 [GRCh38]
ChrX:43552651 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.4(MAOA):c.168+6T>C single nucleotide variant Intellectual disability [RCV001252571] ChrX:43683613 [GRCh38]
ChrX:43542861 [GRCh37]
ChrX:Xp11.3
likely benign
GRCh37/hg19 Xp21.1-11.3(chrX:32849282-43713387)x1 copy number loss not provided [RCV001007291] ChrX:32849282..43713387 [GRCh37]
ChrX:Xp21.1-11.3
pathogenic
NM_000240.4(MAOA):c.1237C>T (p.Pro413Ser) single nucleotide variant not provided [RCV001171566] ChrX:43742022 [GRCh38]
ChrX:43601269 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.21(chrX:539722-55509385)x1 copy number loss not provided [RCV001007224] ChrX:539722..55509385 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
GRCh37/hg19 Xp11.4-11.3(chrX:41150139-43976458) copy number loss Microcephaly [RCV001252950] ChrX:41150139..43976458 [GRCh37]
ChrX:Xp11.4-11.3
pathogenic
NM_000240.4(MAOA):c.739G>A (p.Val247Ile) single nucleotide variant Intellectual disability [RCV001252572] ChrX:43731334 [GRCh38]
ChrX:43590581 [GRCh37]
ChrX:Xp11.3
likely benign
NM_000240.4(MAOA):c.1003A>G (p.Ile335Val) single nucleotide variant Intellectual disability [RCV001252573] ChrX:43732746 [GRCh38]
ChrX:43591993 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.21(chrX:219609-55466476)x1 copy number loss See cases [RCV001263061] ChrX:219609..55466476 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
NM_000240.4(MAOA):c.331G>A (p.Ala111Thr) single nucleotide variant Autistic disorder of childhood onset [RCV001255080] ChrX:43711896 [GRCh38]
ChrX:43571143 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp11.4-11.3(chrX:39645568-44199000) copy number loss Cardiomyopathy [RCV001352652] ChrX:39645568..44199000 [GRCh37]
ChrX:Xp11.4-11.3
pathogenic
NM_000240.4(MAOA):c.233dup (p.Leu78fs) duplication Intellectual disability [RCV001281538] ChrX:43693353..43693354 [GRCh38]
ChrX:43552600..43552601 [GRCh37]
ChrX:Xp11.3
likely pathogenic
NM_000240.4(MAOA):c.411+12G>A single nucleotide variant Brunner syndrome [RCV001336744] ChrX:43711988 [GRCh38]
ChrX:43571235 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp22.33-11.21(chrX:168546-56457794)x1 copy number loss not provided [RCV001281358] ChrX:168546..56457794 [GRCh37]
ChrX:Xp22.33-11.21
pathogenic
NM_000240.4(MAOA):c.1440C>A (p.Asp480Glu) single nucleotide variant Brunner syndrome [RCV001338208] ChrX:43744369 [GRCh38]
ChrX:43603616 [GRCh37]
ChrX:Xp11.3
uncertain significance
GRCh37/hg19 Xp11.4-11.3(chrX:41342834-43901936) copy number loss Global developmental delay [RCV001352647] ChrX:41342834..43901936 [GRCh37]
ChrX:Xp11.4-11.3
pathogenic

Additional Information

Database Acc Id Source(s)
AGR Gene HGNC:6833 AgrOrtholog
COSMIC MAOA COSMIC
Ensembl Genes ENSG00000189221 Ensembl, ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Protein ENSP00000340684 ENTREZGENE, UniProtKB/Swiss-Prot
  ENSP00000440846 ENTREZGENE, UniProtKB/Swiss-Prot
Ensembl Transcript ENST00000338702 ENTREZGENE, UniProtKB/Swiss-Prot
  ENST00000542639 ENTREZGENE, UniProtKB/Swiss-Prot
Gene3D-CATH 3.50.50.60 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
GTEx ENSG00000189221 GTEx
HGNC ID HGNC:6833 ENTREZGENE
Human Proteome Map MAOA Human Proteome Map
InterPro Amino_oxidase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  FAD/NAD-bd_sf UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
  Flavin_amine_oxidase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report hsa:4128 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
NCBI Gene 4128 ENTREZGENE
OMIM 300615 OMIM
  309850 OMIM
Pfam Amino_oxidase UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PharmGKB MAOA RGD, PharmGKB
PRINTS AMINEOXDASEF UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
Superfamily-SCOP SSF51905 UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
UniProt A0A1W5KJW8_HUMAN UniProtKB/TrEMBL
  AOFA_HUMAN UniProtKB/Swiss-Prot, ENTREZGENE
  Q49A63 ENTREZGENE, UniProtKB/TrEMBL
  Q53YE7 ENTREZGENE, UniProtKB/TrEMBL
  Q5UL91_HUMAN UniProtKB/TrEMBL
  Q5UL94_HUMAN UniProtKB/TrEMBL
  Q5ULA3_HUMAN UniProtKB/TrEMBL
  Q5ULA9_HUMAN UniProtKB/TrEMBL
UniProt Secondary B4DF46 UniProtKB/Swiss-Prot
  Q16426 UniProtKB/Swiss-Prot