Kcnmb1<sup>em3Mcwi</sup> (potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin) - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Kcnmb1em3Mcwi (potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Kcnmb1em3Mcwi
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 1; zinc finger nuclease induced mutant 3, Medical College of Wisconsin
RGD ID: 6893420
Description: This allele was made by ZFN mutagenesis. The resulting allele is a 21-bp deletion in exon 2 and intron 2 (del 18906672-18906692)
Type: allele  of Kcnmb1  
Previously known as: Kcnmb1^[em3Mcwi]; Kcnmb1em3Mcwi
Is Marker For: Strains:   SS-Kcnmb1em3Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map10 RGD


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Kcnmb1em3Mcwi-var1 chr10 18559674 18559694 CAGAAAAGGTACAGATCTCTC - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Kcnmb1em3Mcwi
SS-Kcnmb1em3Mcwi    


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_019273 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information