Gene: LOC100912266 (uncharacterized LOC100912266) Rattus norvegicus |
|
Analyze |
|
Symbol: |
LOC100912266 |
Name: |
uncharacterized LOC100912266 |
RGD ID: |
6488109 |
Description: |
|
Type: |
ncrna (Ensembl: protein-coding)
|
RefSeq Status: |
VALIDATED |
Previously known as: |
LRRG00123; LRRGT00103 |
Latest Assembly: |
mRatBN7.2 - mRatBN7.2 Assembly |
Position: |
Rat Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCr8 | 2 | 28,288,798 - 28,297,872 (+) | NCBI | | GRCr8 | | | mRatBN7.2 | 2 | 26,554,062 - 26,563,136 (+) | NCBI | mRatBN7.2 | mRatBN7.2 | | | mRatBN7.2 Ensembl | 2 | 26,554,062 - 26,563,137 (+) | Ensembl | | mRatBN7.2 Ensembl | | | UTH_Rnor_WKY_Bbb_1.0 | 2 | 26,507,930 - 26,517,291 (+) | NCBI | Rnor_WKY | UTH_Rnor_WKY_Bbb_1.0 | | | Rnor_6.0 | 2 | 25,007,218 - 25,016,292 (+) | NCBI | Rnor6.0 | Rnor_6.0 | rn6 | Rnor6.0 | Rnor_6.0 Ensembl | 2 | 25,007,218 - 25,016,293 (+) | Ensembl | Rnor6.0 | | rn6 | Rnor6.0 | Rnor_5.0 | 2 | 44,165,763 - 44,174,838 (+) | NCBI | Rnor5.0 | Rnor_5.0 | rn5 | Rnor5.0 | Celera | 2 | 22,619,885 - 22,628,959 (+) | NCBI | | Celera | | | Cytogenetic Map | 2 | q12 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
References
Genomics
QTLs in Region (mRatBN7.2)
631682 | Bp115 | Blood pressure QTL 115 | 4.3 | 0.0001 | arterial blood pressure trait (VT:2000000) | systolic blood pressure (CMO:0000004) | 2 | 1 | 37410502 | Rat | 738010 | Lnnr3 | Liver neoplastic nodule remodeling QTL 3 | 2.94 | | liver integrity trait (VT:0010547) | liver remodeling tumorous lesion number (CMO:0001461) | 2 | 1 | 41244106 | Rat | 61355 | Bp36 | Blood pressure QTL 36 | 2.9 | | blood pressure trait (VT:0000183) | systolic blood pressure (CMO:0000004) | 2 | 5873687 | 102844969 | Rat | 1600379 | Mcs18 | Mammary carcinoma susceptibility QTL 18 | 2.6 | | mammary gland integrity trait (VT:0010552) | mammary tumor number (CMO:0000343) | 2 | 7887772 | 42804738 | Rat | 738012 | Anxrr3 | Anxiety related response QTL 3 | 3.8 | | exploratory behavior trait (VT:0010471) | percentage of entries into a discrete space in an experimental apparatus (CMO:0000961) | 2 | 9023519 | 54023519 | Rat | 10755430 | Coatc6 | Coat color QTL 6 | | 0.02576 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 2 | 11591100 | 56591100 | Rat | 1578664 | Bmd9 | Bone mineral QTL density 9 | 5 | | femur mineral mass (VT:0010011) | total volumetric bone mineral density (CMO:0001728) | 2 | 11852062 | 49003364 | Rat | 731184 | Mamtr4 | Mammary tumor resistance QTL 4 | | 0.0003 | mammary gland integrity trait (VT:0010552) | mammary tumor number (CMO:0000343) | 2 | 16491740 | 61491740 | Rat | 1357990 | Ael1 | Aortic elastin QTL 1 | 3.1 | 0.00091 | aorta elastin amount (VT:0003905) | aortic elastin | 2 | 19076825 | 64076825 | Rat | 731167 | Glom4 | Glomerulus QTL 4 | 2.4 | 0.0082 | kidney glomerulus morphology trait (VT:0005325) | count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002) | 2 | 20304672 | 65304672 | Rat | 2300168 | Bmd47 | Bone mineral density QTL 47 | 6.6 | 0.0001 | femur mineral mass (VT:0010011) | bone mineral density (CMO:0001226) | 2 | 20662448 | 65662448 | Rat | 10402051 | Gdil2 | Gastrointestinal dilation QTL 2 | | | enteric ganglion morphology trait (VT:0001045) | length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836) | 2 | 24903853 | 74786777 | Rat | 1302794 | Stl27 | Serum triglyceride level QTL 27 | 4.4 | 0.0001 | blood triglyceride amount (VT:0002644) | plasma triglyceride level (CMO:0000548) | 2 | 25413423 | 143657569 | Rat | 1358894 | Kidm24 | Kidney mass QTL 24 | 4.03 | | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 2 | 25413423 | 157142209 | Rat | 1358899 | Kidm23 | Kidney mass QTL 23 | 3.88 | | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 2 | 25413423 | 157142209 | Rat | 1358901 | Cm38 | Cardiac mass QTL 38 | 2 | | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 2 | 25413423 | 157142209 | Rat | 1358904 | Cm39 | Cardiac mass QTL 39 | 2.26 | | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 2 | 25413423 | 157142209 | Rat | 1358910 | Kidm27 | Kidney mass QTL 27 | 5.77 | | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 2 | 25413423 | 157142209 | Rat | 1358911 | Kidm28 | Kidney mass QTL 28 | 5.42 | | kidney mass (VT:0002707) | both kidneys wet weight to body weight ratio (CMO:0000340) | 2 | 25413423 | 157142209 | Rat | 1358913 | Cm41 | Cardiac mass QTL 41 | 2.73 | | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 2 | 25413423 | 203928301 | Rat | 1358917 | Cm42 | Cardiac mass QTL 42 | 2.82 | | heart mass (VT:0007028) | heart weight to body weight ratio (CMO:0000074) | 2 | 25413423 | 203928301 | Rat | 1358887 | Bw50 | Body weight QTL 50 | 2.39 | | body mass (VT:0001259) | body weight (CMO:0000012) | 2 | 25413652 | 157142078 | Rat | 1358908 | Bw49 | Body weight QTL 49 | 3.36 | | body mass (VT:0001259) | body weight (CMO:0000012) | 2 | 25413652 | 157142078 | Rat | |
Markers in Region
D2Rat253 |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 2 | 26,559,817 - 26,560,006 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 2 | 25,012,974 - 25,013,162 | NCBI | Rnor6.0 | Rnor_5.0 | 2 | 44,171,519 - 44,171,707 | UniSTS | Rnor5.0 | RGSC_v3.4 | 2 | 25,663,274 - 25,663,463 | RGD | RGSC3.4 | RGSC_v3.4 | 2 | 25,663,275 - 25,663,463 | UniSTS | RGSC3.4 | RGSC_v3.1 | 2 | 25,583,643 - 25,583,832 | RGD | | Celera | 2 | 22,625,641 - 22,625,829 | UniSTS | | FHH x ACI Map | 2 | 12.2699 | RGD | | FHH x ACI Map | 2 | 12.2699 | UniSTS | |
|
Expression
RNA-SEQ Expression
High: > 1000 TPM value
Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM
Below Cutoff: < 0.5 TPM
|
nervous system |
renal system |
reproductive system |
High |
|
|
|
Medium |
|
|
|
Low |
|
|
2
|
Below cutoff |
1
|
1
|
10
|
Sequence
RefSeq Acc Id: |
ENSRNOT00000078413 ⟹ ENSRNOP00000070141 |
Type: |
CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
mRatBN7.2 Ensembl | 2 | 26,554,062 - 26,563,137 (+) | Ensembl | Rnor_6.0 Ensembl | 2 | 25,007,218 - 25,016,293 (+) | Ensembl |
|
RefSeq Acc Id: |
NR_131102 |
RefSeq Status: |
VALIDATED |
Type: |
NON-CODING |
Position: |
Rat Assembly | Chr | Position (strand) | Source |
---|
GRCr8 | 2 | 28,288,798 - 28,297,872 (+) | NCBI | mRatBN7.2 | 2 | 26,554,062 - 26,563,136 (+) | NCBI | Rnor_6.0 | 2 | 25,007,218 - 25,016,292 (+) | NCBI | Celera | 2 | 22,619,885 - 22,628,959 (+) | NCBI |
|
Sequence: |
ATGGAGAGCCAGAAAGAAGGAGAAGGTGTCTTCTCTGGAATCCAGGTAGAGATTCTTGTTTCTA ATGTCTTCTGGGATAGACTGGGCCTTGAATCTGGTCAGAGAGTCACTGGTTACTCCCACTACGT GTGGGCCACTATTGCTCCAGCGTACTTCACAGGTGGTGGCGACGTGCCCCCCGCCCCCATAGGC TACCAATACTGCTGCCACCAAGGCTCAGCAAGCATGACTGAAGCTGGGGACATCTGTACAACAT CTGCAGATGACTGGGTCCATTG
hide sequence
|
RefSeq Acc Id: |
ENSRNOP00000070141 ⟸ ENSRNOT00000078413 |
Additional Information
Nomenclature History
Date |
Current Symbol |
Current Name |
Previous Symbol |
Previous Name |
Description |
Reference |
Status |
2012-07-05 |
LOC100912266 |
uncharacterized LOC100912266 |
|
|
Symbol and Name status set to provisional |
70820 |
PROVISIONAL |
|
|