Sorcs3<sup>em1Mcwi</sup> (sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Gene: Sorcs3em1Mcwi (sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Sorcs3em1Mcwi
Name: sortilin-related VPS10 domain containing receptor 3; zinc finger nuclease induced mutant 1, Medical College of Wisconsin
RGD ID: 5687731
Description: This allele was made by ZFN mutagenesis. The resulting mutation is a 33-bp insertion in exon 7 (del 1392-1419, ins. Gacgtggtagagcggtgcatcatgagttgtctctggatgcataggtacctgccacatcttgtaataacagcatggtactccgtcatgtgcatatatcttagctgcttcaaatgctccttaattccttgac)
Type: allele  of Sorcs3  
Previously known as: Sorcs3em1Mcwi
Is Marker For: Strains:   FHH-Chr 1BN-Sorcs3em1Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map1 RGD


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Sorcs3em1Mcwi-var1 chr1 247570408 247570435 ATCAGTTCCCTGGTCGTCCAGGATGAAT ANN delins mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Sorcs3em1Mcwi


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts NM_001106367 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information