MIR4655 (microRNA 4655) - Rat Genome Database

Name: MIR4655
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| FTP Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner Aging & Age-Related Disease Cancer Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: MIR4655 (microRNA 4655) Homo sapiens

Analyze

Symbol:

MIR4655

Name:

microRNA 4655

RGD ID:

5134179

HGNC Page

HGNC

Description:

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

Type:

ncrna

RefSeq Status:

PROVISIONAL

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38.p13 Ensembl	7	1,844,180 - 1,844,253 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh38	7	1,844,180 - 1,844,253 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	7	1,883,816 - 1,883,889 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Cytogenetic Map	7	p22.3	NCBI
HuRef	7	1,803,412 - 1,803,485 (-)	NCBI		HuRef
CHM1_1	7	1,883,300 - 1,883,373 (-)	NCBI		CHM1_1
CRA_TCAGchr7v2	7	1,936,728 - 1,936,801 (-)	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

cyclosporin A (EXP)

References

Additional References at PubMed

PMID:16381832	PMID:21199797

Genomics

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	39044
Count of gene targets:	14899
Count of transcripts:	34481
Interacting mature miRNAs:	hsa-miR-4655-3p, hsa-miR-4655-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	sensory system	adipose tissue	appendage
High
Medium		1	3		11		1			1
Low	29	12	19	10	127	12	47	15	40	22	27	42	2	6	9
Below cutoff	19	6	7	2	22	3	12	24	19	10	16	19		2	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NG_011518	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_039799	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC104129	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENST00000580817

RefSeq Status:

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p13 Ensembl	7	1,844,180 - 1,844,253 (-)	Ensembl

RefSeq Acc Id:

NR_039799

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	7	1,844,180 - 1,844,253 (-)	NCBI
GRCh37	7	1,883,816 - 1,883,889 (-)	ENTREZGENE
HuRef	7	1,803,412 - 1,803,485 (-)	ENTREZGENE
CHM1_1	7	1,883,300 - 1,883,373 (-)	NCBI
CRA_TCAGchr7v2	7	1,936,728 - 1,936,801 (-)	ENTREZGENE

Sequence:

show sequence

CCAAGGGCACACCGGGGATGGCAGAGGGTCGTGGGAAAGTGTTGACCCTCGTCAGGTCCCCGGG
GAGCCCCTGG

hide sequence

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 7p22.3-q36.3(chr7:54185-159282390)x1	copy number loss	See cases [RCV000135401]	Chr7:54185..159282390 [GRCh38] Chr7:54185..159075079 [GRCh37] Chr7:149268..158767840 [NCBI36] Chr7:7p22.3-q36.3	pathogenic
GRCh38/hg38 7p22.3-15.2(chr7:54185-26827634)x3	copy number gain	See cases [RCV000136557]	Chr7:54185..26827634 [GRCh38] Chr7:54185..26867253 [GRCh37] Chr7:149268..26833778 [NCBI36] Chr7:7p22.3-15.2	pathogenic
GRCh38/hg38 7p22.3-22.2(chr7:54185-3324143)x1	copy number loss	See cases [RCV000136789]	Chr7:54185..3324143 [GRCh38] Chr7:54185..3363775 [GRCh37] Chr7:149268..3330301 [NCBI36] Chr7:7p22.3-22.2	pathogenic
GRCh38/hg38 7p22.3(chr7:1330987-2530644)x1	copy number loss	See cases [RCV000136673]	Chr7:1330987..2530644 [GRCh38] Chr7:1370623..2570278 [GRCh37] Chr7:1337149..2536804 [NCBI36] Chr7:7p22.3	uncertain significance
GRCh38/hg38 7p22.3-22.1(chr7:54185-6638027)x3	copy number gain	See cases [RCV000136731]	Chr7:54185..6638027 [GRCh38] Chr7:54185..6677658 [GRCh37] Chr7:149268..6644183 [NCBI36] Chr7:7p22.3-22.1	pathogenic
GRCh38/hg38 7p22.3(chr7:791215-1993065)x3	copy number gain	See cases [RCV000136691]	Chr7:791215..1993065 [GRCh38] Chr7:830852..2032700 [GRCh37] Chr7:797378..1999226 [NCBI36] Chr7:7p22.3	uncertain significance
GRCh38/hg38 7p22.3-21.3(chr7:45130-7252065)x3	copy number gain	See cases [RCV000137524]	Chr7:45130..7252065 [GRCh38] Chr7:45130..7291696 [GRCh37] Chr7:140213..7258221 [NCBI36] Chr7:7p22.3-21.3	pathogenic
GRCh38/hg38 7p22.3(chr7:1085248-2530644)x4	copy number gain	See cases [RCV000137818]	Chr7:1085248..2530644 [GRCh38] Chr7:1124884..2570278 [GRCh37] Chr7:1091410..2536804 [NCBI36] Chr7:7p22.3	uncertain significance
GRCh38/hg38 7p22.3-15.3(chr7:45130-25221165)x3	copy number gain	See cases [RCV000137824]	Chr7:45130..25221165 [GRCh38] Chr7:45130..25260784 [GRCh37] Chr7:140213..25227309 [NCBI36] Chr7:7p22.3-15.3	pathogenic
GRCh38/hg38 7p22.3(chr7:689554-2031521)x3	copy number gain	See cases [RCV000138319]	Chr7:689554..2031521 [GRCh38] Chr7:729191..2071156 [GRCh37] Chr7:695717..2037682 [NCBI36] Chr7:7p22.3	uncertain significance
GRCh38/hg38 7p22.3-15.2(chr7:1698124-27207295)x3	copy number gain	See cases [RCV000143060]	Chr7:1698124..27207295 [GRCh38] Chr7:1737760..27246914 [GRCh37] Chr7:1704286..27213439 [NCBI36] Chr7:7p22.3-15.2	pathogenic
GRCh38/hg38 7p22.3-22.2(chr7:54165-3258775)x1	copy number loss	See cases [RCV000142995]	Chr7:54165..3258775 [GRCh38] Chr7:54165..3298407 [GRCh37] Chr7:149248..3264933 [NCBI36] Chr7:7p22.3-22.2	pathogenic
GRCh38/hg38 7p22.3-22.2(chr7:45130-3406236)x3	copy number gain	See cases [RCV000143175]	Chr7:45130..3406236 [GRCh38] Chr7:45130..3445868 [GRCh37] Chr7:140213..3412394 [NCBI36] Chr7:7p22.3-22.2	uncertain significance
GRCh38/hg38 7p22.3-15.2(chr7:43360-27196404)x3	copy number gain	See cases [RCV000143586]	Chr7:43360..27196404 [GRCh38] Chr7:43360..27236023 [GRCh37] Chr7:138443..27202548 [NCBI36] Chr7:7p22.3-15.2	pathogenic
GRCh38/hg38 7p22.3-14.1(chr7:54185-41875885)x3	copy number gain	See cases [RCV000051159]	Chr7:54185..41875885 [GRCh38] Chr7:54185..41915483 [GRCh37] Chr7:149268..41882008 [NCBI36] Chr7:7p22.3-14.1	pathogenic
GRCh38/hg38 7p22.3-22.1(chr7:45130-5880375)x1	copy number loss	See cases [RCV000052249]	Chr7:45130..5880375 [GRCh38] Chr7:45130..5920006 [GRCh37] Chr7:140213..5886532 [NCBI36] Chr7:7p22.3-22.1	pathogenic
GRCh38/hg38 7p22.3-q36.3(chr7:53985-159282531)x1	copy number loss	See cases [RCV000052250]	Chr7:53985..159282531 [GRCh38] Chr7:53985..159075220 [GRCh37] Chr7:149068..158767981 [NCBI36] Chr7:7p22.3-q36.3	pathogenic
GRCh38/hg38 7p22.3-22.1(chr7:45130-6270185)x3	copy number gain	See cases [RCV000053527]	Chr7:45130..6270185 [GRCh38] Chr7:45130..6309816 [GRCh37] Chr7:140213..6276341 [NCBI36] Chr7:7p22.3-22.1	pathogenic
GRCh38/hg38 7p22.3-15.3(chr7:53985-24361531)x3	copy number gain	See cases [RCV000053528]	Chr7:53985..24361531 [GRCh38] Chr7:53985..24401150 [GRCh37] Chr7:149068..24367675 [NCBI36] Chr7:7p22.3-15.3	pathogenic
GRCh38/hg38 7p22.3-21.3(chr7:54185-8274834)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053529]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053529]\|See cases [RCV000053529]	Chr7:54185..8274834 [GRCh38] Chr7:54185..8314464 [GRCh37] Chr7:149268..8280989 [NCBI36] Chr7:7p22.3-21.3	pathogenic
GRCh38/hg38 7p22.3-14.2(chr7:54185-37089712)x3	copy number gain	See cases [RCV000053530]	Chr7:54185..37089712 [GRCh38] Chr7:54185..37129317 [GRCh37] Chr7:149268..37095842 [NCBI36] Chr7:7p22.3-14.2	pathogenic

Additional Information

External Database Links

Database	Acc Id	Source(s)
COSMIC	MIR4655	COSMIC
Ensembl Genes	ENSG00000265089	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000580817	ENTREZGENE
GTEx	ENSG00000265089	GTEx
HGNC ID	HGNC:41754	ENTREZGENE
Human Proteome Map	MIR4655	Human Proteome Map
miRBase	MI0017283	ENTREZGENE
NCBI Gene	100616160	ENTREZGENE
RNAcentral	URS00003B66C6	RNACentral
	URS0000576E6E	RNACentral
	URS000075EACC	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)