Mthfr<sup>em1Mcwi</sup> (methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin) - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Gene: Mthfrem1Mcwi (methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin) Rattus norvegicus
Analyze
Symbol: Mthfrem1Mcwi
Name: methylenetetrahydrofolate reductase (NAD(P)H); zinc finger nuclease induced mutant 1, Medical College of Wisconsin
RGD ID: 5131961
Description: This allele was made by zinc finger nuclease mutagenesis. The resulting mutation is an 28-bp frameshift deletion in exon 2 (del 165-192).
Type: allele  of Mthfr  
Previously known as: Mthfr^[em1Mcwi]; Mthfrem1Mcwi
Is Marker For: Strains:   SS-Mthfrem1Mcwi  
Latest Assembly: mRatBN7.2 - mRatBN7.2 Assembly
Position:
Rat AssemblyChrPosition (strand)SourceGenome Browsers
JBrowseNCBIUCSCEnsembl
Cytogenetic Map5 RGD


References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains

Genomics

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Mthfrem1Mcwi-var1 chr5 158467728 158467755 ATCTGAGGGCAGCAGCAGTGGCAGCGAG - deletion mRatBN7.2

Related Rat Strains
The following Strains have been annotated to Mthfrem1Mcwi


Expression


Sequence

Nucleotide Sequences
RefSeq Transcripts XM_342975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information